Method for preparing micro-ecological preparation and application thereof

A technology of microecological preparations and hydrogen sulfide, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of weak hydrogen sulfide production ability and cannot be used as microecological preparations, and achieve the effect of extensive health care

Inactive Publication Date: 2010-03-10
ZHEJIANG UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the normal microbial flora in the intestinal tract does not have or only has a very weak ability to produce hydrogen sulfide. Although Salmonella and many spoilage bacteria have strong hydrogen sulfide production ability, they cannot be used as probiotics because they are pathogenic bacteria.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing micro-ecological preparation and application thereof
  • Method for preparing micro-ecological preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1-1

[0045] (1) Take rat liver tissue, after homogenization, extract total RNA by conventional methods of molecular biology;

[0046] (2) PCR primers for synthesizing cystathionine γ-lyase (CSE), the forward primer is 5'-ATGCCTCGAGATGCAGAAGGACGCCTCTTTGAG-3', and the reverse primer is 5'-ATGCATGCGCGGCCGCTTAAGGGTGCGCTGCCTTCAA-3';

[0047] (3) Using the total RNA extracted in (1) as a template, using the cystathionine γ-lyase primer synthesized in (2), carry out reverse transcription polymerase chain reaction (RT-PCR) with a reverse transcription kit. The reaction product was electrophoresed in 1% agarose gel, and the band with a size of about 1200bp was cut, and recovered with a gel-tapping recovery kit;

[0048] (4) Digest the PCR purified product in (3) with Xho| and Not| double enzymes, mix it with the yeast-Escherichia coli shuttle plasmid pGAPZ that has been digested by the same enzyme, connect it under the action of ligase, and transform it into Escherichia coli DH5α In strain...

Embodiment 1-2

[0052] (1) Take mouse pancreas tissue, after homogenization, extract total RNA with conventional methods (kit) of molecular biology;

[0053] (2) PCR primers for synthesizing cystathionine β-synthetase (CBS), the forward primer is 5'CGCATGCATCGTCCCCAGCATGCAGAAGAA3', and the reverse primer is 5'-CGCCTCGAG-CAGTTATTCAGAAGGTCTGGCCC-3';

[0054] (3) Using the total RNA extracted in (1) as a template, and using the cystathionine β-synthetase primer synthesized in (2), perform reverse transcription polymerase chain reaction (RT-PCR). The reaction product was electrophoresed in 1% agarose gel, and the band of about 1700bp was cut, and recovered by tapping gel recovery kit;

[0055] (4) Digest the purified PCR product in (3) with Nsi| and Xho|, mix it with the same digested lactic acid bacteria expression plasmid pNICE:sec, connect it under the action of ligase, and transform it into Lactococcus lactis NZ9000 In the competent cells, positive clones were screened;

[0056] (5) Statica...

Embodiment 1-3

[0059] (1) Isolation and screening of hydrogen sulfide producing bacteria from the natural environment by conventional methods;

[0060] (2) extracting the total DNA of the hydrogen sulfide producing bacteria screened in (1) by freezing and thawing;

[0061] (3) Synthesize the 3' end and 5' end primers of cysteine ​​desulfurase, the forward primer is: 5'-GCATTGAGCCATGGACGGAGTTTA-3', the reverse primer is: 5'-CCGATTAAAGCTTAGCCCATTCGA-3';

[0062] (4) Using the total bacterial DNA extracted in (2) as a template, and using the forward and reverse primers synthesized in (3), perform polymerase chain reaction. After the reaction product was electrophoresed in 1% agarose gel, the part with a size of about 1300bp was cut and recovered, and the purified PCR product was digested with Nco| and Hand III, and connected to the pET 28b+ expression vector;

[0063] (5) transforming the cloned vector into competent cells of Escherichia coli BL-21 strain with calcium chloride treatment, and s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for preparing a micro-ecological preparation and an application thereof. At present, hypertension needs to be controlled by medicines with side effect. By cloning a hydrogen sulfide generation enzyme gene to an expression carrier and converting the carrier into a receptor bacterium, the invention obtains an engineering strain which can express a hydrogen sulfide generation enzyme with high efficiency, and the micro-ecological preparation is prepared after culture and is used as the base material of a medicine for treating hypertension. The method comprises thefollowing concrete steps: cloning the hydrogen sulfide generation enzyme gene into the expression carrier; converting the expression carrier into a receptor cell to obtain a converter; and culturingthe converter until the logarithmic growth later period and collecting thalli as the micro-ecological preparation, namely, a live thallus carrying the hydrogen sulfide generation enzyme gene. By the application of the micro-ecological preparation prepared by the method as hypertension medicine, a patient can ingest a little lactose or other auxiliary food every day, and the engineering strain cannormally grow and propagate in the intestinal tract, thereby frequent administration is not needed, and no side effect exists.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and in particular discloses a preparation method and application of probiotics. technical background [0002] With the progress of society and the improvement of people's material living standards, the incidence of cardiovascular and cerebrovascular diseases is also increasing, the most common of which is hypertension. According to reports, 26.4% of adults (about 972 million) in the world suffer from hypertension or high blood pressure, and the number of hypertensive patients in my country has reached 160 million. Hypertension not only leads to a decline in the quality of life of patients, but also causes diseases such as stroke, myocardial infarction, and renal failure, which seriously threaten the lives of patients. At present, cardiovascular and cerebrovascular diseases have surpassed cancer and infectious diseases and become the leading cause of death in China. Therefore, controlling the o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/74C12N15/81A61K48/00A61P9/12C12R1/19C12R1/01C12R1/865
Inventor 吴根福
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap