Glycerol dehydratase gene, vector, engineering bacteria and application thereof

A technology of glycerol dehydratase and genetically engineered bacteria, which can be used in genetic engineering, application, plant genetic improvement, etc., and can solve the problems of low enzyme activity and high cost of coenzyme vitamin B12

Active Publication Date: 2010-03-17
ZHEJIANG UNIV OF TECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing glycerol dehydratases all have problems such as low enzyme activity and high cost of coenzyme vitamin B12, which have become bottlenecks limiting the large-scale industrial production of glycerol dehydratase. Therefore, the construction of glycerol dehydratase genetically engineered bacteria with industrial applications Significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycerol dehydratase gene, vector, engineering bacteria and application thereof
  • Glycerol dehydratase gene, vector, engineering bacteria and application thereof
  • Glycerol dehydratase gene, vector, engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] The total genomic DNA of Lactobacillus reuteriZJB-09105 strain (CCTCC NO: M 209213) was extracted with a rapid nucleic acid extractor, and the genomic DNA was used as a template in primer 1 (CAGTTCCAGGTGTTCCGG) and primer 2 (ATGAAACGCCAGAAACGCT). Under the effect of PCR amplification.

[0081] The amount of each component in the PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer (TaKaRa), 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), cloning primer 1 and primer at a concentration of 50 μM 2 1 μL of each, 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase (TaKaRa), 40 μL of nucleic acid-free water.

[0082] Using Biorad’s PCR instrument, the PCR reaction conditions are: pre-denaturation at 94°C for 5 minutes, then enter the temperature cycle at 94°C for 30s, 55°C for 1.5min, and 72°C for 2min, a total of 35 cycles, and finally extend at 72°C for 10min, and the termination temperature is 8°C .

[0083] Take 5 μL of the ...

Embodiment 2

[0085] According to the analysis results of Example 1, expression primer 3 (GCCGAATTCATGAAACGCCAGAAACGCTTTGAAG) and primer 4 (AATAAGCTTCAGTTCCAGGTGTTCCGGATCCAGAG) were designed, and EcoRI and HindIII restriction enzyme sites were introduced in primer 3 and primer 4 respectively. Initiated by primers 3 and 4, the high-fidelity Pyrobest DNA polymerase was used to amplify to obtain a glycerol dehydratase gene fragment with a length of 1674bp. After sequencing, the amplified fragment was treated with EcoRI and HindIII restriction endonucleases. And use T4 DNA ligase to connect the fragment with the expression vector pET28b treated with the same restriction endonuclease to construct the expression vector pET28b-dhaB. The constructed expression vector pET28b-dhaB was electrotransformed into Escherichia coli BL21, spread on a plate and cultured at 37°C overnight, and the clones were randomly selected to extract the plasmids for enzyme digestion identification. The identification resul...

Embodiment 3

[0087] The recombinant Escherichia coli BL21 / pET28b-dhaB containing the expression recombinant plasmid pET28b-dhaB verified in Example 2 was cultured with LB liquid medium containing 50 μg / ml kanamycin resistance for 12 hours, and then inoculated with a volume ratio of 1%. Inoculate into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, and cultivate to the cell concentration OD 600 About 0.6, then add IPTG with a final concentration of 0.5mM to the LB liquid medium, induce culture for 8 hours, centrifuge at 4°C, 5000rpm for 10min, and collect the bacterial cells containing recombinant glycerol dehydratase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glycerol dehydratase gene for coding glycerol dehydratase, a recombinant vector containing the gene, a recombinant gene engineering bacteria obtained by the transformation ofthe recombinant vector and an application thereof for preparing the recombinant glycerol dehydratase. The glycerol dehydratase gene can obtain an intracellular expression recombinant plasmid or a secretory expression recombinant plasmid by connection and construction with an expression vector, then the intracellular expression recombinant plasmid or the secretory expression recombinant plasmid isrespectively and correspondingly transformed to an escherichia coli strain and obtains the recombinant escherichia coli which contains recombinant glycerol dehydratase, and can recombine the escherichia coli to carry out biocatalysis and transformation for an enzyme source. As an enzyme for transformation, the recombinant glycerol dehydratase can respectively adopt glycerol, 1, 2-propylene glycolor alcohol as primer and carry out transformation reaction so as to prepare corresponding 3-hydroxypropionaldehyde, propionaldehyde or aldehyde and the like.

Description

(1) Technical field [0001] The invention relates to a glycerol dehydratase gene encoding glycerol dehydratase, a recombinant vector containing the gene, a recombinant genetically engineered bacterium obtained by transforming the recombinant vector, and its application in preparing the recombinant glycerol dehydratase. (2) Background technology [0002] Glycerol dehydratase can catalyze glycerol, 1,2-propanediol and ethanol to generate 3-hydroxypropionaldehyde, propionaldehyde and acetaldehyde respectively, and has broad application prospects in the chemical synthesis industry. Glycerol dehydratase mainly exists in Klebsiella, Lactobacillus, Citrobacter freundii, Clostridium pasteurianus. Glycerol dehydratase is a heteromorphic hexamer formed by association of three subunits of αβγ through non-covalent hydrophobic interaction, and can only exert its catalytic effect in the presence of coenzyme vitamin B12. [0003] At present, glycerol dehydratase genes from different source...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/60C12N1/20C12N15/63C12N1/21C12N9/88C12P7/24C12R1/225C12R1/19
Inventor郑裕国柳志强平丽英张烽薛亚平沈寅初
OwnerZHEJIANG UNIV OF TECH