Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing ultra-low molecular weight heparin

A technology of molecular weight and heparin, applied in the field of preparation of ultra-low molecular weight heparin, can solve the problems of restricting the development of low molecular weight heparin, no technical research reports, high cost, etc., and achieves great industrial application value, reduces costs, and improves efficiency.

Inactive Publication Date: 2010-03-17
TSINGHUA UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the heparinase used in these methods needs to go through multi-step purification steps, and the yield is low, which causes the cost of the enzyme to be very expensive (the price of the commodity heparinase I produced by the heparin yellow liver bacteria provided by Canada IBEX company is $200 / 0.1IU), which greatly limits the development of enzymatic preparation of low molecular weight heparin
The use of recombinant strains to produce heparanase I is a very promising approach, but usually recombinant heparanase I is very easy to form inclusion bodies and requires a complex renaturation process to form active proteins
In addition, in the process of enzymatic degradation of heparin, by controlling the degradation time and other conditions, it is theoretically possible to prepare ultra-low molecular weight heparin, but there is no relevant technical research report so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing ultra-low molecular weight heparin
  • Method for preparing ultra-low molecular weight heparin
  • Method for preparing ultra-low molecular weight heparin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1, acquisition of fusion protein (MBP-HepA) of maltose binding protein-heparanase I

[0043] 1. Construction of engineering bacteria expressing MBP-HepA

[0044] 1. Construction of the expression vector pMal-hepA containing the gene encoding heparanase I

[0045] The construction process of the expression vector pMAL-hepA is as follows: figure 1 As shown, the specific process is as follows: amplify the heparanase I gene from the genomic DNA of Flavabacterium heparinum (Flavabacterium heparinum) (purchased from IAM), and the upstream and downstream primers used are respectively 5' GCCT GGATCC CAGCAAAAAAAAATCCGGTAAC3' (the underlined base is the enzyme recognition site of BamHI), 5'CTTA AAGCTT TTACTATCTGGCAGTTTCGCTGTAC 3' (underlined bases are HindIII enzyme recognition sites), respectively introduce BamHI and HindIII enzyme recognition sites.

[0046] The reaction system for PCR amplification is: 50ng template DNA, 100pmol of each primer, 1× amplification...

Embodiment 2

[0058] Embodiment 2, production of ultra-low molecular weight heparin and its detection

[0059] 1. Production of ultra-low molecular weight heparin

[0060] 1. The device for the production of ultra-low molecular weight heparin of the present invention

[0061] The fusion protein of maltose-binding protein and heparanase I produces the reaction device of ultra-low molecular weight heparin such as Figure 4 Shown, including reactor 1 with agitator, ultrafiltration device 2 and liquid storage tank 3; among them. The ultrafiltration device 2 is a cross-flow ultrafiltration membrane (the flow direction of the reflux liquid is perpendicular to the flow direction of the filtrate), and includes an ultrafiltration membrane 4 , a reflux liquid outlet 5 , a filtrate outlet 7 , and a reaction liquid inlet 8 . The reaction liquid outlet of the reactor 1 is connected with the reaction liquid inlet 8 of the ultrafiltration device 2 through a pump, the reflux liquid outlet 5 of the ultraf...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apertureaaaaaaaaaa
Diameteraaaaaaaaaa
Extinction coefficientaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing ultra-low molecular weight heparin. The method comprises the steps: using maltose binding protein-heparinase I fusion protein to degrade the heparin in substrate, and obtaining the ultra-low molecular weight heparin; the maltose binding protein-heparinase I fusion protein has amino acid residue sequence of SEQ ID No: 1 in a sequence table; and the dosage of the maltose binding protein-heparinase I fusion protein is 0.4-4.0 IU / g of the heparin, preferentially 1.6IU / g of the heparin. Therefore, the ultra-low molecular weight heparin produced by utilizing the fusion protein has ideal average molecular weight and narrow molecular weight distribution range, thus having great industrial application value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for preparing ultra-low molecular weight heparin. Background technique [0002] Heparin is a mucopolysaccharide formed by hexuronic acid (L-iduronic acid, D-glucuronic acid) and D-glucosamine sulfate with alternating 1→4 glycosidic bonds, and has a linear chain of six- or eight-saccharide repeating units Like structure, its molecular weight is between 3000-37000, and the average molecular weight is 15000. Since heparin was first discovered in 1916, its application in medicine as an anticoagulant and antithrombotic agent has attracted more and more attention. In addition, heparin also has various biological functions such as anti-inflammation, anti-allergy, anti-virus, anti-cancer, and blood lipid regulation. However, because heparin has anticoagulant activity, a large amount of heparin will cause side effects such as bleeding and induction of thrombocytopenia, which greatl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/14C12N15/70C12N9/96C12R1/19
Inventor 邢新会叶逢春张翀
Owner TSINGHUA UNIV