Method for preparing ultra-low molecular weight heparin
A technology of molecular weight and heparin, applied in the field of preparation of ultra-low molecular weight heparin, can solve the problems of restricting the development of low molecular weight heparin, no technical research reports, high cost, etc., and achieves great industrial application value, reduces costs, and improves efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1, acquisition of fusion protein (MBP-HepA) of maltose binding protein-heparanase I
[0043] 1. Construction of engineering bacteria expressing MBP-HepA
[0044] 1. Construction of the expression vector pMal-hepA containing the gene encoding heparanase I
[0045] The construction process of the expression vector pMAL-hepA is as follows: figure 1 As shown, the specific process is as follows: amplify the heparanase I gene from the genomic DNA of Flavabacterium heparinum (Flavabacterium heparinum) (purchased from IAM), and the upstream and downstream primers used are respectively 5' GCCT GGATCC CAGCAAAAAAAAATCCGGTAAC3' (the underlined base is the enzyme recognition site of BamHI), 5'CTTA AAGCTT TTACTATCTGGCAGTTTCGCTGTAC 3' (underlined bases are HindIII enzyme recognition sites), respectively introduce BamHI and HindIII enzyme recognition sites.
[0046] The reaction system for PCR amplification is: 50ng template DNA, 100pmol of each primer, 1× amplification...
Embodiment 2
[0058] Embodiment 2, production of ultra-low molecular weight heparin and its detection
[0059] 1. Production of ultra-low molecular weight heparin
[0060] 1. The device for the production of ultra-low molecular weight heparin of the present invention
[0061] The fusion protein of maltose-binding protein and heparanase I produces the reaction device of ultra-low molecular weight heparin such as Figure 4 Shown, including reactor 1 with agitator, ultrafiltration device 2 and liquid storage tank 3; among them. The ultrafiltration device 2 is a cross-flow ultrafiltration membrane (the flow direction of the reflux liquid is perpendicular to the flow direction of the filtrate), and includes an ultrafiltration membrane 4 , a reflux liquid outlet 5 , a filtrate outlet 7 , and a reaction liquid inlet 8 . The reaction liquid outlet of the reactor 1 is connected with the reaction liquid inlet 8 of the ultrafiltration device 2 through a pump, the reflux liquid outlet 5 of the ultraf...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Aperture | aaaaa | aaaaa |
| Diameter | aaaaa | aaaaa |
| Extinction coefficient | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 