High-level expression of tetanus toxin receptor binding domain Hc in Escherichia coli and application

A tetanus toxin-receptor binding technology, applied in the field of genetic engineering, can solve the problems of toxoid toxicity reversal, side effects, pollution, etc.

Active Publication Date: 2010-11-10
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional toxoid vaccines are refined from tetanus toxin through formaldehyde detoxification and aluminum adjuvant adsorption. Although the immune effect is good, there are still some problems: certain side effects occur after inoculation of toxoid; Bacteria can form spores, which are highly toxic, and there is a certain risk in the production of vaccines; toxoids treated with formaldehyde are likely to cause pollution; toxoids after chemical treatment may undergo toxicity reversal; and the important thing is that the immunity period is short. Tetanus immunity declines, children need booster immunization every 4 to 6 years, adults need booster immunization every 10 years
[0004] It is of great significance to use E. coli to express the subunit vaccine against tetanus toxin. The process is simple, and the recombinant Hc protein does not need to worry about being contaminated by the complete toxin, and its safety is relatively high. However, the currently expressed tetanus Hc fragment is generally expressed Low amount, easy to form inclusion bodies, low immune titer and other disadvantages, this is because the AT content in the Hc sequence is rich and there are a large number of rare codons in Escherichia coli, which limits its expression to a certain extent
Many researchers at home and abroad have improved the expression of the tetanus Hc segment, and the expression level has been increased to a certain extent, but it still cannot meet the needs of mass production, and the prepared Hc immunogenicity is also lower than that of traditional toxoid vaccines. lower

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-level expression of tetanus toxin receptor binding domain Hc in Escherichia coli and application
  • High-level expression of tetanus toxin receptor binding domain Hc in Escherichia coli and application
  • High-level expression of tetanus toxin receptor binding domain Hc in Escherichia coli and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. Sequence Optimization of Tetanus Toxin Subunit Vaccine Hc,

[0039] According to the sequencing results of 64008 virulent strains of Clostridium tetani C.Tetani in China (GeneBank sequence number: AF154828), the Tet-Hc sequence of 451Aa was analyzed and optimized (the sequence comparison before and after optimization is as follows), and the codons commonly used in Escherichia coli were replaced rare codons, and reduced the AT content of the optimized sequence from 72.57% to 52.47%. EcoRI and XhoI restriction sites were added to both ends of the Tet-Hc sequence, and a TAA stop codon was added before the start codon to terminate the expression of Trx protein on the vector pET32a(+), and the whole gene synthesis was carried out.

[0040] Comparison before and after Hc sequence optimization:

[0041] Before optimizationAAAAATCTGGATTGTTGGGTTGATAATGAAGAAGATATAGATGTTATATTAAAAAAGAGT

[0042] Optimized AAAAACCTTGATTGTTGGGTCGACAACGAAGAAGACATCGATGTTTATCCTGAAAAAGTCT

...

Embodiment 2

[0087] Example 2. Construction of Tetanus Toxin Subunit Vaccine Hc Expression Vector

[0088] After the optimized synthetic Tet-Hc gene was digested with EcoRI and XhoI, it was connected to the expression vector pET32a(+) which was also digested with EcoRI and XhoI, transformed into Escherichia coli competent cell DH5α, and cultured overnight at 37°C . The next day, single clones were picked and placed in 5 mL LB (Amp+) medium, cultured at 37°C, 220 rpm for 12 hours, plasmids were extracted, EcoRI and XhoI double enzyme digestion was performed to identify the insertion of the target gene, and sent for sequencing. The correctly sequenced plasmid was named pET32a-Tet-Hc. Example 3. Escherichia coli expression and western-blot identification of tetanus toxin recombinant subunit vaccine Hc

Embodiment 3

[0088] After the optimized synthetic Tet-Hc gene was digested with EcoRI and XhoI, it was connected to the expression vector pET32a(+) which was also digested with EcoRI and XhoI, transformed into Escherichia coli competent cell DH5α, and cultured overnight at 37°C . The next day, single clones were picked and placed in 5 mL LB (Amp+) medium, cultured at 37°C, 220 rpm for 12 hours, plasmids were extracted, EcoRI and XhoI double enzyme digestion was performed to identify the insertion of the target gene, and sent for sequencing. The correctly sequenced plasmid was named pET32a-Tet-Hc. Example 3. Escherichia coli expression and western-blot identification of tetanus toxin recombinant subunit vaccine Hc

[0089] The pET32a(+) vector correctly connected into the Tet-Hc gene was transformed into Escherichia coli competent cell BL21(DE3), and a single clone was picked and cultured in 5mL LB(Amp+) liquid medium at 37°C and 220rpm until OD600nm≌0.6 , adding IPTG with a final concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for a tetanus toxin receptor binding domain Hc to be subjected to high-level soluble expression in Escherichia coli through nucleotide sequence optimization. According to the sequencing result of a domestic C.Tetani virulent strain CMCC64008, the tetanus toxin receptor binding domain Hc sequence is analyzed and optimized, the optimized sequence is SEQ ID No.1 and the coded protein sequence is SEQ ID No.2. The synthesized Hc gene is linked into an expression vector pET32a(+) after undergoing double enzyme digestion, the recombinant Hc is subjected to high soluble expression in Escherichia coli and the target protein accounts for about 46% of the total protein in the supernatant undergoing bacteriociasis. After QFF column purification, phenyl hydrophobic column purification and SP column purification, the purity of the target protein can be more than 95% and the yield thereof is more than 300mg / L. The recombinant protein prepared by the method of the invention has good immunogenicity, can induce the mice to produce high-titre protective antibodies and can resist attack of high-dose lethal toxins. The method has extensive application prospect in large-scale high-level preparation of the tetanus toxin recombinant subunit vaccine Hc.

Description

Technical field: [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tetanus toxin receptor binding region Hc gene and its coded protein and its application as a subunit vaccine in tetanus prevention. technical background: [0002] Tetanus is a disease that seriously endangers people's lives and health. It is an acute and specific disease caused by Gram-positive, anaerobic Clostridium tetani, which invades human wounds, grows and reproduces, and produces tetanus toxin. Sexual infection, tetanus toxin invasion of the nervous system can lead to generalized muscle spasm, and then systemic failure or suffocation to death. All open injuries have the possibility of tetanus. The toxicity of tetanus toxin is very strong, second only to botulinum toxin, and about 100ng of tetanus toxin can cause death. Tetanus is very serious in the vast poor and backward third world countries and regions. It is estimated that about 1,000,000 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C07K14/33C12N15/63C12N5/10C12N1/00C12P21/02A61K39/08A61P31/04C12R1/145
Inventor陈薇于蕊侯利华于长明刘树玲任军房婷
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE