Chrysanthemum photoperiod-sensitive gene and application thereof

A technology of photoperiod and chrysanthemum, applied in application, genetic engineering, plant genetic improvement, etc.

Inactive Publication Date: 2010-12-22
BEIJING FORESTRY UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, there are no related reports on photoperiod-sensitive genes in chrysanthemums

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chrysanthemum photoperiod-sensitive gene and application thereof
  • Chrysanthemum photoperiod-sensitive gene and application thereof
  • Chrysanthemum photoperiod-sensitive gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1.Isolation and Identification of CmFT Gene

[0030] method

[0031] 1. Material selection

[0032] The mixture of test material leaves and flower buds was taken from the groundcover chrysanthemum variety 'Jiyue Taohua' and stored in a -80°C ultra-low temperature refrigerator for later use.

[0033] 2. Design primers

[0034] Except for the universal primers in the RACE test, which are included with the kit (3'RACE universal primer sequence is shown in the 3'Full RACE Core Set Ver. The following table.

[0035]

[0036]

[0037] 3. Extraction and electrophoresis analysis of total RNA and DNA

[0038] A. Extraction of total RNA (using liquid nitrogen grinding method)

[0039]1) Take 500 μL of lysate RLT, transfer it into a 1.5 mL centrifuge tube, add 5 μL of β-mercaptoethanol to a final concentration of 1%, then add 50 μL of PLANTaid and mix well for later use.

[0040] 2) Grind an appropriate amount of plant tissue (the mixture of leaves and flower b...

Embodiment 2

[0115] Example 2. Genetic transformation of CmFT gene

[0116] Using the plant expression vector pBI121 as the basic skeleton, the sense and antisense expression vectors of CmFT were constructed, which were named pBI-CmFTf and pBI-CmFTr respectively. The sense expression vector pBI-CmFTf introduces specific restriction sites Xba I and Sma I at both ends of the target gene, and the antisense expression vector pBI-CmFTr introduces reverse restriction sites Sma I and Xba I at both ends of the target gene. RT-PCR amplifies the target gene CmFT with high fidelity, connects it to the pGM-T intermediate vector, double-digests pBI121 and the intermediate vector respectively, recovers the large fragment of the vector and the target fragment, and then performs directional sticky end-blunt end ligation and enzyme All identification.

[0117] 1. Amplification of the target fragment

[0118] According to the CmFT gene sequence, two pairs of sense and antisense primers containing Xba I an...

Embodiment 3

[0185] Embodiment 3. to the application of light-sensitive gene CmFT

[0186] 1. Import CmFT into Arabidopsis for functional verification

[0187] Arabidopsis thaliana (A. thaliana ecotype Columbia) was used as the transformation population, and it was planted in a mixed growth medium of peat and vermiculite (volume ratio 1:1) at a culture temperature of 22-24 °C and a humidity of 60-70%, the light cycle is 16h / 8h (light / dark), and the light intensity is 3000lux in the light incubator. The Agrobacterium strain LBA4404 of the constructed plant expression vector pBI-CmFTf was transformed into the model plant Arabidopsis thaliana by flower organ soaking method, the resistant plants were screened, and molecular identification and phenotype analysis were carried out.

[0188] 1) Using Arabidopsis total DNA, negative control wild-type Arabidopsis total DNA, and positive control plasmid DNA as templates, design a pair of specific primers CmFT-GUS1: CAGCGACAACAGGAGCACAG and CmFT-GUS2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chrysanthemum photoperiod-sensitive gene CmFT and application of the CmFT gene in chrysanthemum photoperiod sensitivity. In the invention, the CmFT, an FT homologous gene, is separated out from chrysanthemums by using a homologous gene cloning method as well as a RACE technology, the gene has a nucleotide sequence as shown in SEQ ID No.1, and the CmFT belongs to FT subfamily members. The CmFT is relevant to chrysanthemum photosensitivity. After transforming the gene into model plant Arabidopsis thaliana and common chrysanthemum varieties by genetic transformation, the result shows that the gene can adjust the photoperiod of chrysanthemums and promote flowering.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a chrysanthemum photoperiod sensitive gene FT homologous gene (named CmFT), and also relates to the application of the CmFT gene in regulating the photoperiod sensitivity of chrysanthemums. Background technique [0002] Chrysanthemum (Chrysanthemum morifolium Ramat.) is a perennial herbaceous flower of the genus Chrysanthemum in the family Compositae (Asteraceae). [0003] According to the flowering period, chrysanthemums can be divided into four types: summer chrysanthemum (flowering from June to September), autumn chrysanthemum (flowering from October to November), cold chrysanthemum (flowering from December to next January), and four seasons chrysanthemum (flowering in four seasons). The currently cultivated chrysanthemums are mainly autumn chrysanthemums, and there are relatively few chrysanthemum varieties in other seasons. There are problems such as rela...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10A01H5/00
Inventor张启翔潘才博高亦珂蔡明石少川
OwnerBEIJING FORESTRY UNIVERSITY