Peanut ferrous transport protein as well as encoding gene and application thereof

A protein and peanut technology, applied in application, genetic engineering, plant genetic improvement and other directions, to achieve great application prospects and improve the effect of utilization efficiency

Active Publication Date: 2012-07-18
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Peanut is a Mechanism I plant, and there is no related research report on the peanut ferrous iron transporter AhNRAMP1 gene. Therefore, the research on the function of this gene family will improve and promote the absorption of iron in the environment, transport in the body and transfer to the grain. Provide important theoretical basis and technical basis, thereby further providing an important technical approach for cultivating iron-resistant peanut varieties from molecular breeding or genetic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peanut ferrous transport protein as well as encoding gene and application thereof
  • Peanut ferrous transport protein as well as encoding gene and application thereof
  • Peanut ferrous transport protein as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Peanut seeds 'Luhua 14' (purchased from the Chinese Academy of Agricultural Sciences) were sterilized with 10% hydrogen peroxide for 20-30 minutes, cleaned and placed in saturated calcium sulfate solution for about 8 hours, while ventilating and avoiding light, and then placed on the floor Put them in a tray of absorbent paper, and cover them with several layers of absorbent paper. After pouring an appropriate amount of water, place them in an artificial culture room away from light. The culture room was set at 30°C for 14 hours with light and 22°C for 10 hours with darkness. About 1-2 days after the peanuts germinate, they are transferred to quartz sand for cultivation, and after 1-2 leaves grow, they are transferred to hydroponic nutrient solution for cultivation. The formula of hydroponic nutrient solution is as follows: KH 2 PO 4 (0.5mM), K 2 SO 4 (0.75mM), KCl(0.1mM), MgSO 4 .7H 2 O(0.65mM), CaSO 4 .2H 2 O(2mM), H 3 BO3 (1μM), MnSO 4 .4H 2 O(1μM), ZnSO ...

Embodiment 2

[0027] Put the peanut root and leaf samples that have been stored in a -80 degree refrigerator into a mortar that has been pre-cooled with liquid nitrogen, add liquid nitrogen to quickly grind the plant samples until they become powdery, take out about 0.1 grams of powder samples in 1.5 ml 1 ml of RNA extraction solution Trizol (purchased from Invitrogen) was quickly added to the RNase-free centrifuge tube. Immediately shake the mixture of the sample and Trizol vigorously with a vortex shaker for about 15 seconds to fully dissociate the nucleoprotein, let stand at room temperature for 5 minutes, add 200 microliters of chloroform, mix well, let stand for 5 minutes, put Centrifuge at a speed of 12,000×g for 15 minutes in a centrifuge that has been pre-cooled to 4°C in advance, take the supernatant into a new 1.5 ml centrifuge tube, add 500 μl of isopropanol, mix well by inverting up and down, and store at room temperature. Stand for 10 minutes, then centrifuge at 12,000×g at 4°C...

Embodiment 3

[0029] Using CLONTECH PCR-Select TM The cDNA Subtraction Kit (purchased from Clontech Company) was used to carry out inhibitory subtractive hybridization with peanut root samples in peanut monoculture and peanut / corn intercropping. The specific steps are detailed in the kit manual, and a 490bp peanut AhNRAMP1 gene fragment was obtained.

[0030] Primers were designed with known fragment sequences, peanut root RNA was used as template, and Super ScriptII reverse transcriptase kit from Invitrogen Company was used, Oligo(dT)15 was used as primer, and reverse transcription cDNA template was obtained by reacting at 42°C. Through Clonetech company RACE kit (SMART TM RACE cDNA Amplification Kit) was used for PCR reaction, respectively cloned and sequenced to obtain the 5' and 3' ends of the AhNRAMP1 gene (see the kit instructions for methods). The 5' end cloning primers are:

[0031] AhNRAMP-5’-GSPGCCAATCCACGAAGGCAGTGATGAGG

[0032] The 3' end cloning primer is

[0033] AhNRAMP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant molecular biology, in particular to a peanut ferrous transport protein gene as well as an encoding gene and application thereof. The invention discloses peanut ferrous transport protein AhNRAMP1 which is (1) a protein formed by an amino acid sequence shown as SEQ ID No.2, or (2) a protein formed by substituting, deleting or adding one or more amino acids in the amino acid sequence shown as SEQ ID No.2 and derived from (1), equal activity. The invention also discloses a gene for encoding the protein. The utilization efficiency on iron and the content of the iron in kernels can be improved by applying the new species of leguminous plants cultivated by the AhNRAMP1 provided by the invention.

Description

technical field [0001] The invention relates to the field of plant molecular biology, in particular to a ferrous iron transport protein in peanut root system, its encoding gene and application. Background technique [0002] The micronutrient iron is an essential element for the growth and development of various organisms. Iron deficiency in plants will seriously inhibit the growth and development of plants, resulting in a decline in yield and quality. Plants are the most fundamental food source for animals and humans. Therefore, it is of great significance to promote the absorption of iron in the environment by plants, the rational operation of plants and the accumulation of iron in grains to improve crop yield and quality and promote human health. Iron is the third limiting nutrient for plant growth, mainly due to the low solubility of iron in an aerobic environment (Yi et al., 1994). In fact, more than one-third of the soil in the world is deficient in iron. In order to a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10A01H5/00
Inventor左元梅熊宏春申红芸王朋飞张福锁
OwnerCHINA AGRI UNIV