Double-control double-regulation prokaryotic expression vector system and construction method and application thereof
A technology of expression vector and vector system, which is applied in the field of double control and double regulation prokaryotic expression vector system and its construction, can solve the problems of host cell toxicity, inability to obtain target protein, host cell death, etc., and achieve highly strict and wide expression control. The effect of strong spectrum and broad spectrum enhancement
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1: the construction of double control double regulation prokaryotic expression vector system pESP-1 carrier (vector)
[0028] Design primers:
[0029] Introduce the BglII restriction site and the SP6 promoter sequence SP6 promoter sequence (ATTTAGGTGACACTATAGAA) in the downstream primer Primer2 primer, the upstream and downstream primer sequences are as follows:
[0030] Primer1:
[0031] ATCGAGATCTCGATCCTCTACGCCG (SEQ ID NO: 1)
[0032] Primer2:
[0033] GGATAGATCTCGATCCCGCGAAATATTTAGGTGACACTATAGAAGAATTGTGAGCGGATAACAATTCCCC (SEQ ID NO: 2)
[0034] PCR reaction:
[0035] Using the plasmid pET11a (shown in SEQ ID NO: 11) as a template, PCR amplification was performed.
[0036] PCR system: 5 μl of 10×PCR buffer, 15mM MgCl 2 4 μl, 1 μl of 10mM dNTPmix, 2 μl each of 10 μM Primer 1 and 2, 20-200 pg of template DNA, 0.5 μl of Taq DNA polymerase (5U / μl), and replenish water to 50 μl.
[0037] The reaction conditions are: pre-denaturation at 94°C for 5 minutes...
Embodiment 2
[0061] Example 2: Construction of double-controlled double-regulated prokaryotic expression vector system pARA-SP6 plasmid (plasmid)
[0062] Preparation of pARA vector fragment:
[0063] Plasmid pARA13 (GenBank: AF121783.1) was digested with Pst I and HindIII respectively: in a 20 μl reaction system, add 2 μl of 10× digestion buffer, 500 ng of DNA, and 0.5 μl of restriction endonuclease (10 U / μl) , add sterile double distilled water to make up to 20 μl, and react at 37°C for 1 to 2 hours. Agarose gel electrophoresis was used to detect the digestion results, and the target fragments were recovered.
[0064] Preparation of SP6RNA polymerase (SP6RNA polymerase) gene insert:
[0065] Design primers:
[0066] Using the sequence of the SP6 RNA polymerase gene (GenBank: Y00105.1) as a reference, a bioengineering company was commissioned to synthesize the entire gene of the SP6 RNA polymerase fragment.
[0067] Design the upstream primer Primer3, the downstream primer Primer4, th...
Embodiment 3
[0100] Example 3: Construction and gene expression of pET11a-SCDase and pESP-1-SCDase plasmids
[0101] Preparation of SCDase Insert:
[0102] Ceramide sphingolipid deacylase (Sphingolipid ceramide deacylase, Genbank No.: AB079849) whole gene (2979bp) removes 324 amino acids (972bp) at the C-terminal to obtain ceramide sphingolipid deacylase highly active gene (2007bp) (Masako Furusato, Noriyuki Sueyoshi, Susumu Mitsutake, et al. Molecular Cloning and Characterization of Sphingolipid Ceramide N-Deacylase from a MarineBacterium, Shewanella alga G8. J. Biol. Chem., 2002, 277(19): 17300-17307), commissioned by Bioengineering Company gene synthesis.
[0103] Design primers:
[0104] Taking the sequence of the high activity gene (2007bp) of ceramide sphingidyl deacylase as a reference, design the upstream primer Primer5, the downstream primer Primer6, the upstream primer introduces the BamH I restriction site, the downstream primer introduces the Bpu1102 restriction site, the ups...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com