Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Double-control double-regulation prokaryotic expression vector system and construction method and application thereof

A technology of expression vector and vector system, which is applied in the field of double control and double regulation prokaryotic expression vector system and its construction, can solve the problems of host cell toxicity, inability to obtain target protein, host cell death, etc., and achieve highly strict and wide expression control. The effect of strong spectrum and broad spectrum enhancement

Inactive Publication Date: 2011-09-07
INNER MONGOLIA UNIV FOR THE NATITIES
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression products of some target genes can also have a toxic effect on the host cell, causing the death of the host cell, and the target protein to be expressed cannot be obtained.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-control double-regulation prokaryotic expression vector system and construction method and application thereof
  • Double-control double-regulation prokaryotic expression vector system and construction method and application thereof
  • Double-control double-regulation prokaryotic expression vector system and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: the construction of double control double regulation prokaryotic expression vector system pESP-1 carrier (vector)

[0028] Design primers:

[0029] Introduce the BglII restriction site and the SP6 promoter sequence SP6 promoter sequence (ATTTAGGTGACACTATAGAA) in the downstream primer Primer2 primer, the upstream and downstream primer sequences are as follows:

[0030] Primer1:

[0031] ATCGAGATCTCGATCCTCTACGCCG (SEQ ID NO: 1)

[0032] Primer2:

[0033] GGATAGATCTCGATCCCGCGAAATATTTAGGTGACACTATAGAAGAATTGTGAGCGGATAACAATTCCCC (SEQ ID NO: 2)

[0034] PCR reaction:

[0035] Using the plasmid pET11a (shown in SEQ ID NO: 11) as a template, PCR amplification was performed.

[0036] PCR system: 5 μl of 10×PCR buffer, 15mM MgCl 2 4 μl, 1 μl of 10mM dNTPmix, 2 μl each of 10 μM Primer 1 and 2, 20-200 pg of template DNA, 0.5 μl of Taq DNA polymerase (5U / μl), and replenish water to 50 μl.

[0037] The reaction conditions are: pre-denaturation at 94°C for 5 minutes...

Embodiment 2

[0061] Example 2: Construction of double-controlled double-regulated prokaryotic expression vector system pARA-SP6 plasmid (plasmid)

[0062] Preparation of pARA vector fragment:

[0063] Plasmid pARA13 (GenBank: AF121783.1) was digested with Pst I and HindIII respectively: in a 20 μl reaction system, add 2 μl of 10× digestion buffer, 500 ng of DNA, and 0.5 μl of restriction endonuclease (10 U / μl) , add sterile double distilled water to make up to 20 μl, and react at 37°C for 1 to 2 hours. Agarose gel electrophoresis was used to detect the digestion results, and the target fragments were recovered.

[0064] Preparation of SP6RNA polymerase (SP6RNA polymerase) gene insert:

[0065] Design primers:

[0066] Using the sequence of the SP6 RNA polymerase gene (GenBank: Y00105.1) as a reference, a bioengineering company was commissioned to synthesize the entire gene of the SP6 RNA polymerase fragment.

[0067] Design the upstream primer Primer3, the downstream primer Primer4, th...

Embodiment 3

[0100] Example 3: Construction and gene expression of pET11a-SCDase and pESP-1-SCDase plasmids

[0101] Preparation of SCDase Insert:

[0102] Ceramide sphingolipid deacylase (Sphingolipid ceramide deacylase, Genbank No.: AB079849) whole gene (2979bp) removes 324 amino acids (972bp) at the C-terminal to obtain ceramide sphingolipid deacylase highly active gene (2007bp) (Masako Furusato, Noriyuki Sueyoshi, Susumu Mitsutake, et al. Molecular Cloning and Characterization of Sphingolipid Ceramide N-Deacylase from a MarineBacterium, Shewanella alga G8. J. Biol. Chem., 2002, 277(19): 17300-17307), commissioned by Bioengineering Company gene synthesis.

[0103] Design primers:

[0104] Taking the sequence of the high activity gene (2007bp) of ceramide sphingidyl deacylase as a reference, design the upstream primer Primer5, the downstream primer Primer6, the upstream primer introduces the BamH I restriction site, the downstream primer introduces the Bpu1102 restriction site, the ups...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biological gene engineering, and particularly relates to a double-control double-regulation prokaryotic expression vector system and a construction method and application thereof. Two expression vectors finish expression of a target gene in the vector system, wherein one expression vector is a main expression vector, and the target gene is cloned on the expression vector; the other expression vector is an auxiliary expression vector, and the auxiliary expression vector controls a switch for regulating the promoter of the main expression vector; the main expression vector contains an SP6 promoter and a lactose regulating gene; the auxiliary expression vector contains an arab promoter, an araC regulating gene and an SP6RNA polymerase gene; and the target gene expressed by the main expression vector and the auxiliary expression vector are controlled and / or regulated by an inducer.

Description

technical field [0001] The invention belongs to the field of genetic engineering of molecular biology, and specifically relates to a dual-control and double-regulation prokaryotic expression vector system and its construction method and application. Background technique [0002] Gene expression (protein synthesis) vectors in prokaryotic cells are generally single vectors, that is, a plasmid is transferred into a competent cell to complete the expression of the target gene and achieve the synthesis of the target protein. This form of expression vector has simple operation procedures and high transformation efficiency when transforming the expression vector into competent cells. However, in the gene expression (protein synthesis) process of this kind of expression vector, the control and regulation system on the carrier is not strict to the control of gene expression, and there are often missing expressions, which cause some genes whose expression products are toxic to Escheri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/66
Inventor 翟景波陈永胜李国瑞
Owner INNER MONGOLIA UNIV FOR THE NATITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com