Supercharge Your Innovation With Domain-Expert AI Agents!

Chemiluminescent immunity imaging detection method of EV71 (Enterovirus) virus

A chemiluminescence immunoassay, imaging detection technology, applied in chemical instruments and methods, antiviral immunoglobulins, biochemical equipment and methods, etc., can solve the problems of long time, nucleic acid degradation, false negative test results, etc., and achieve easy operation. , high sensitivity and specificity

Inactive Publication Date: 2011-09-07
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing virus detection technology has the following weaknesses: First, the sample processing is difficult, such as the extraction of viral nucleic acid, especially the extraction of viral RNA, which has high requirements for experimental conditions and operators, otherwise it is easy to cause degradation of nucleic acid , resulting in false negative test results
The second is that the experiment takes a long time, and the detection of viral nucleic acid takes at least several hours or even longer
Third, the experimental operation is complex and requires special equipment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chemiluminescent immunity imaging detection method of EV71 (Enterovirus) virus
  • Chemiluminescent immunity imaging detection method of EV71 (Enterovirus) virus
  • Chemiluminescent immunity imaging detection method of EV71 (Enterovirus) virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Preparation of EV71 whole virus rabbit anti-polyclonal antibody and virus VP1 protein rabbit anti-polyclonal antibody:

[0040] A pair of primers were designed according to the genome VP1 gene sequence of EV71 virus BrCr-TR strain (GenBank: AB204852.1), VP1-F: GAGAGTTCTATAGGGGACAGT, VP1-R: AGCTGTGCTATGTGAATTAGGAA, and the amplified fragment was 891bp. To facilitate the cloning of PCR products, a BamHI and SalI restriction site were added to the upstream and downstream primers, respectively. The primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. Extract EV71 virus HB0803 strain RNA, carry out PCR amplification after reverse transcription, obtain VP1 gene (see figure 1 ). The obtained PCR product recovered by DNA gel recovery kit (produced by Shanghai Sangon Bioengineering Co., Ltd.) was connected to vector pMD-18T (purchased from Dalian TaKaRa Company), and then transformed into Escherichia coli DH5α to obtain recombinant plasmid. The sequence det...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an EV71 (Enterovirus) virus detection method based on magnetic microsphere separation and chemiluminescent immunity imaging. The method mainly comprises the following steps of: coupling an EV71 virus rabbit anti polyclonal antibody with a magnetic microsphere; adding a sample to be detected and the magnetic microsphere to a micropore plate to ensure that the virus in the sample to be detected is bonded with a virus polyclonal antibody; then adding a biotinlated EV71 virus VP1 protein rabbit anti polyclonal antibody to ensure that the EV71 virus VP1 protein rabbit anti-polyclonal antibody is in specific reaction with the sample to be detected; adding SA-HRP (Streptavidin-Horseradish Peroxide) to be bonded with biotin so as to form a magnetic microsphere-polyclonal antibody-virus-polyclonal antibody-HRP compound finally; and adding a chemiluminescent substrate, and detecting chemiluminescent intensity. In the invention, the chemiluminescent intensity is in direct proportion to the concentration of the virus to be detected, and a linear relation between the chemiluminescent intensity and the concentration of the EV71 virus to be detected can be obtained. The EV71 virus detection method has the advantages of simplicity and convenience for operation, high sensitivity, strong specificity and the like, and can better meet the demand of clinical detection of the EV71 virus.

Description

technical field [0001] The invention relates to a detection method for EV71 virus, the main pathogenic agent of hand, foot and mouth disease, and belongs to the technical field of immunodetection and the technical field of chemiluminescence immunoassay. The enterovirus EV71-HB0803 strain was preserved by the China Center for Type Culture Collection (Address: School of Life Sciences, Wuhan University, Luojia Mountain, Wuchang, Wuhan, 430072), the preservation date is September 30, 2010, and the preservation number is CCTCC NO: V201020. Background technique [0002] Enterovirus 71 (Enterovirus 71, EV71) is the main pathogen of hand-foot-mouth disease (HFMD), which belongs to the Picornaviridae family and a member of the Enterovirus genus. Single-stranded positive-sense RNA. EV71 virus often causes large-scale outbreaks of hand, foot and mouth disease in infants and young children, and can lead to severe cases and even death cases. In 1998, 129,106 HFMD cases and 78 deaths i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/543C12N15/41C12N15/63C07K14/085C07K16/10C07K16/06
Inventor 王汉中何治柯张万坡陈璐李海刚
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More