Unlock instant, AI-driven research and patent intelligence for your innovation.

Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor

A technology of intestinal trefoil factor and expression vector, which is applied in the fields of biotechnology and engineering, can solve the problems of cumbersome purification methods, unstable plasmids, and high costs, and achieve the goals of avoiding methanol pollution and fire hazards, simple fermentation methods, and good biological activity Effect

Inactive Publication Date: 2011-10-12
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But its defect is: when it is expanded from the laboratory to the industrial scale, its output declines rapidly, because the selection pressure of the high copy number of the Werther plasmid in the medium disappears, the plasmid becomes unstable, and the copy number decreases, resulting in a decrease in the output. The reduction is only 48mg / L; its purification method is cumbersome, complicated operation and many steps
However, according to the method it introduces, it has the following disadvantages: 1. The intestinal trefoil factor is obtained by expressing eukaryotic cells. Although the protein activity is still good, the cost is high, the yield is low, and it is difficult to produce on a large scale; 2. The intestinal mucosa is used to extract the intestinal trefoil factor. Leaf factor, although natural intestinal trefoil factor can be obtained, its source of raw material (intestinal mucosa) is limited, the yield is very low, and it cannot be used for large-scale industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor
  • Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor
  • Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Construction of recombinant expression vector

[0039] The intestinal trefoil factor gene sequence amplified by RT-PCR was double digested with EcoRI and NotI, then ligated with the yeast secretion expression vector pGAPZɑA treated with the same restriction enzymes, and transformed into Escherichia coli Top10, Recombinant plasmids were screened on low-salt LB plates with a concentration of 20-30 μg / ml Zeocin, and recombinant E. coli Top10 containing recombinant yeast expression plasmid pGAPZɑA-ITF was obtained. See the steps for details figure 1 ,details as follows:

[0040]1. The intestinal trefoil factor gene sequence amplified by RT-PCR, according to the hITF mRNA sequence (Accession No NM003226) retrieved in GeneBank, using the mature peptide cDNA coding region (180bp) of hITF as a template, using Primer 5.0 software Design the following primers, hITF upstream primer: 5′-gaga gaattc caccaccaccaccaccacgaggagtacgtgggcctgtc -3′; hITF downstream primer: 5′...

Embodiment 2

[0066] The preparation of embodiment 2 engineering bacteria

[0067] The recombinant yeast expression plasmid was extracted from the recombinant Escherichia coli Top10 obtained in Example 1, transformed into yeast GS115 after linearization by single enzyme digestion, and positive transformants were screened with zeocinYPD plate at a concentration of 100 μg / mL.

[0068] 1. Preparation of GS115 Competent Yeast

[0069] 1) Inoculate GS115 yeast into 50ml YPD medium, shake the bacteria overnight at 30°C (about 24-28h) and cultivate until the OD value is 0.8-1.0 (about 10 8 Cells / ml);

[0070] 2) Harvest the yeast, wash once with 25ml sterile water, and centrifuge at 1500g for 10 minutes at room temperature;

[0071] 3) Resuspend the yeast in 1mL of 100mM lithium chloride solution, and transfer the suspension to a 1.5ml centrifuge tube;

[0072] 4) Centrifuge at the maximum speed of the centrifuge for 15 seconds to precipitate the bacteria, and resuspend the bacteria in 400 μL ...

Embodiment 3

[0120] Example 3 Using engineering bacteria to prepare intestinal trefoil factor

[0121] 1. Fermentation

[0122] Inoculate the prepared seed medium into the 10L fermentation medium of a 30L fermenter, use a wide range of inorganic salt medium as the fermentation medium, use glucose as the carbon source, no methanol induction and staged fermentation, continuous fermentation for 2 days . Specific steps are as follows:

[0123] 1) Strains: the engineered bacteria obtained in Example 2, that is, the recombinant Pichia pastoris pGAPZɑA-ITF-GS115 strain.

[0124] 2) Medium

[0125] Seed medium:

[0126] Peptone 20g, D-glucose 20g, yeast extract 10g, dilute to 1L.

[0127] Fermentation Basal Salt Medium BSM: 85% H 3 PO 4 26.7ml / L, CaSO 4 2H 2 O 0.93g / L, K 2 SO 4 18.2g / L, MgSO 4 2H 2 O 14.9g / L, KOH 4.13g / L, glycerin 40g / L, PTM1 4.0ml / L

[0128] Among them: PTM1 trace element medium:

[0129] CuSO 4 ·5H 2 O 6.0g / L, KI 0.088g / L, MnSO 4 ·H 2 O 3.0g / L, Na 2 MoO 4 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a process which uses pGAP as a promoter and Pichia Yeast GS115 as an engineering bacterium to perform fermentation expression on an intestinal trefoil factor (ITF) in a fermentation tank. The method comprises the following steps: the recombinant Pichia Yeast expression vector pGAPZ alpha A-ITF is firstly constructed and then recombined in Escherichia coli Top10 to amplify, Escherichia coli plasmid is extracted and linearized to be transformed in Saccharomyce GS115, a high copy transformant is screened according to the zeocin resistance gene carried by the vector to perform constitutive expression, a high expression pilot test engineering bacterium is screened and fermented in a culture medium for 2 days to perform secretory expression on the ITF; and the target protein ITF of which the purity is more than 95% is obtained through purification treatment, wherein the output is about 200mg / L and the yield is about 50%. The intestinal trefoil factor recombinant expression vector has low production cost, short fermentation period and simple purification method; methanol induction is not adopted, the protein expression level is high; and a good foundation is laid for the large-scale industrial production of ITF.

Description

technical field [0001] The invention belongs to the field of biotechnology and engineering, in particular to a preparation method of intestinal trefoil factor. Background technique [0002] Intestinal trefoil factor (ITF for short) is a specific small molecule protein distributed in the intestinal tract, with a molecular weight of about 6-7kD. ITF consists of 59 amino acid residues, including a specific sequence consisting of 38-39 amino acid residues, in which 6 cysteines form 3 cysteines in the order of 1-5, 2-4, 3-6. Disulfide bonds, resulting in a specific and stable three-lobed structure. This stable structure ensures its activity in the gut, independent of digestive enzymes and pH changes. Under normal circumstances, ITF is distributed throughout the small intestine, especially at the base of the small intestinal villous ring cells. ITF exists in the form of 20% monomer and 80% dimer in vivo, but only the dimer has biological activity. ITF can not only promote the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12N1/19C12P21/02
Inventor 彭曦金星万千雪吴丹
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA