Yeast engineered bacteria for expressing recombinant prawn protein Pen9 and its preparation method and uses
A technology of prawn protein and protein, applied in the field of yeast engineering bacteria expressing recombinant prawn protein Pen9 and its preparation and application, which can solve the problems of bacterial drug resistance, residue, affecting product quality and export earnings
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0107] Example 1 Extraction of total RNA of Penaeus vannamei and synthesis of the first strand of cDNA
[0108] The vannamei were reared in an oxygenated water tank at 22°C for use. Select healthy shrimp during the moulting period, rinse with DEPC-treated sterilized water, collect 750 μL of hemolymph from the abdominal sinus of the shrimp with a 2.5 mL disposable syringe, add an equal volume of anticoagulant (pH 7.0), and microscopically examine Counting, take the cell content as 1×10 7 The hemolymph was centrifuged at 4°C and 800 g for 15 min, the supernatant was removed, and the blood cells were collected. Total RNA was extracted according to the product manual of Qiagen's RNeasy Mini Kit. Store the extracted RNA solution at -80°C for future use.
[0109] Using Oligo(dT)15 as a primer, the Universal Riboclone cDNASynthesis System kit from Promega was used to synthesize the first strand of cDNA by reverse transcription according to the operation manual. The specific opera...
Embodiment 2
[0110] Embodiment 2 Amplification of the Penaeidin gene of Penaeus vannamei
[0111] 1. Synthesis of amplification primers
[0112] Design primers, upstream primer P1: 5′ GAATTC GCCATGGGGTACAGGGGCGGTTACACA 3′ (EcoRI site is underlined); downstream primer P2: 5′ TCTAGA GCCTTGTCATCGTCATTCTCTTTTACTAAGTGACAACA 3' (Xbal site underlined). Primers were synthesized by Alpha Company, USA.
[0113] 2. PCR amplification of the target gene
[0114] According to the operation manual of the Reverse Transcription Reaction kit, the target gene Penaeidin was amplified by PCR using the first strand of cDNA synthesized by reverse transcription as a template. PCR reaction system: 10×reaction buffer, 5 μL; 1.5 mM MgCl2, 3 μL; 0.2 mM dNTP, 1 μL; 20 pmol upstream primer P1, 1 μL; 20 pmol downstream primer P2, 1 μL; 5U / μL Taq DNA polymerase 1 μL; template 6 μL; Sterile water to a final volume of 50 µL. PCR reaction conditions: 95°C, 5min; 94°C, 30s; 53°C, 45s; 72°C, 30s (35 cycles); 72°C, 5min...
Embodiment 3
[0116] Construction and identification of embodiment 3 recombinant plasmid pGEM-T / Pen
[0117] 1. Recovery of PCR products
[0118] A DNA gel recovery kit (product of Omega Company) was used to recover PCR product fragments according to the instructions of the DNA gel recovery kit of Omega Company. The specific operation steps are as follows:
[0119] (1) The above PCR product is subjected to 1.2% agarose gel electrophoresis (1×TAE), and the electrophoresis situation is observed with an ultraviolet lamp. When the DNA band to be recovered is completely separated from other bands, the electrophoresis is stopped and cut with a blade under an ultraviolet lamp. The band to be recovered is purified with a PCR product purification kit.
[0120] (2) Crush the glue in an Eppendorf tube, add an equal volume of sol solution Binding Buffer, bathe in water at 65°C for 7 minutes, and shake the Eppendorf tube every 2 minutes until the glue is completely melted.
[0121] (3) Add the melted...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com