Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof
A technology of SF-P9 and prawn protein, which is applied in botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem of small molecular weight and achieve the effect of inhibiting the growth of tumor cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0116] Example 1 Amplification and Cloning of Penaeidin Gene of Penaeus vannamei
[0117] 1. Design and synthesis of amplification primers:
[0118] According to the prawn peptide pen-2 gene, a pair of primers P1 and P2 were designed. The primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by PAGE. The nucleotide sequences of P1 and P2 are respectively: upstream primer P1: 5'GAATTCTACAGGGGCGGTTACACA 3'. Downstream primer P2: 5' TCTAGAGCCTTGTCATCGTCATTCTCTTTTACTAAGTGACAACA 3'.
[0119] 2. Extraction of total RNA of Penaeus vannamei and synthesis of the first strand of cDNA:
[0120] The vannamei were reared in an oxygenated water tank at 22°C for use. Select healthy shrimp during the moulting period, rinse with DEPC-treated sterilized water, collect 750 μL of hemolymph from the abdominal sinus of the shrimp with a 2.5 mL disposable syringe, add an equal volume of anticoagulant (pH 7.0), and microscopically examine Counting, take the cell conten...
Embodiment 2
[0151] Example 2 Construction and Identification of Recombinant Shuttle Plasmid pPIC6αA / Pen
[0152] 1. Construction of recombinant shuttle plasmid pPIC6αA / Pen:
[0153] Extract the recombinant plasmid pGEM-T / Pen, use Eco RI and Xba I double enzyme digestion to obtain the target fragment Pen; similarly digest pPIC6αA empty vector. The Pen obtained after double enzyme digestion and the empty vector pPIC6αA DNA fragment were subjected to the action of T4 DNA ligase overnight at 16° C. to obtain the recombinant plasmid pPIC6αA / Pen.
[0154] The connection reaction system is as follows:
[0155] pPIC6αA vector DNA fragment: 2 μl; penaeidin DNA fragment: 10 μl; T4 DNA buffer: 1.5 μl; T4 DNA ligase: 1.5 μl.
[0156] Transform Escherichia coli with the recombinant plasmid pPIC6αA / Pen E. coli JM109 competent cells, positive clones were screened on LB plates containing 300 μg / ml blasticidin (Blasticidin) to obtain Escherichia coli strains E. coli JM109 (pPIC6αA / Pen). Using...
Embodiment 3
[0167] Example 3 Transformation of recombinant shuttle plasmid pPIC6αA / Pen Pichia pastoris X-33
[0168] 1. Linearization of recombinant shuttle plasmid pPIC6αA / Pen DNA:
[0169] Prepare a small amount of recombinant plasmid pPIC6αA / Pen DNA15-20μg, digest with RNaseA at 37°C for 30 min, and then use restriction endonuclease in a 60μL system Sac I perform enzyme digestion and linearization, keep warm in a water bath at 37°C for 4 hours, extract once with phenol:chloroform (25:24), extract once with chloroform:isoamyl alcohol (24:1), add 0.1 volume of 3M acetic acid Sodium (pH5.2), 2.5 times the volume of absolute ethanol, mix well and place at -20°C to precipitate overnight, centrifuge at 4°C, 12000rpm for 20min, discard the supernatant, wash twice with 75% ethanol prepared with ultrapure water, After drying naturally, dissolve the precipitate with 5-10 μL TE solution, and store at -20°C for later use. restriction endonuclease Sac I digestion of the linearized vector pl...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
