Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof

A technology of SF-P9 and prawn protein, which is applied in botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem of small molecular weight and achieve the effect of inhibiting the growth of tumor cells

Active Publication Date: 2013-05-01
HUBEI TAIYANGHONG BIOLOGICAL TECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Penaeidins have the basic commonality of antimicrobial peptides in primary and secondary structures, but the common features in structure and biological function are: (1) small molecular weight

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof
  • Recombined litopenaeus setiferus protein SF-P9, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Example 1 Amplification and Cloning of Penaeidin Gene of Penaeus vannamei

[0117] 1. Design and synthesis of amplification primers:

[0118] According to the prawn peptide pen-2 gene, a pair of primers P1 and P2 were designed. The primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. and purified by PAGE. The nucleotide sequences of P1 and P2 are respectively: upstream primer P1: 5'GAATTCTACAGGGGCGGTTACACA 3'. Downstream primer P2: 5' TCTAGAGCCTTGTCATCGTCATTCTCTTTTACTAAGTGACAACA 3'.

[0119] 2. Extraction of total RNA of Penaeus vannamei and synthesis of the first strand of cDNA:

[0120] The vannamei were reared in an oxygenated water tank at 22°C for use. Select healthy shrimp during the moulting period, rinse with DEPC-treated sterilized water, collect 750 μL of hemolymph from the abdominal sinus of the shrimp with a 2.5 mL disposable syringe, add an equal volume of anticoagulant (pH 7.0), and microscopically examine Counting, take the cell conten...

Embodiment 2

[0151] Example 2 Construction and Identification of Recombinant Shuttle Plasmid pPIC6αA / Pen

[0152] 1. Construction of recombinant shuttle plasmid pPIC6αA / Pen:

[0153] Extract the recombinant plasmid pGEM-T / Pen, use Eco RI and Xba I double enzyme digestion to obtain the target fragment Pen; similarly digest pPIC6αA empty vector. The Pen obtained after double enzyme digestion and the empty vector pPIC6αA DNA fragment were subjected to the action of T4 DNA ligase overnight at 16° C. to obtain the recombinant plasmid pPIC6αA / Pen.

[0154] The connection reaction system is as follows:

[0155] pPIC6αA vector DNA fragment: 2 μl; penaeidin DNA fragment: 10 μl; T4 DNA buffer: 1.5 μl; T4 DNA ligase: 1.5 μl.

[0156] Transform Escherichia coli with the recombinant plasmid pPIC6αA / Pen E. coli JM109 competent cells, positive clones were screened on LB plates containing 300 μg / ml blasticidin (Blasticidin) to obtain Escherichia coli strains E. coli JM109 (pPIC6αA / Pen). Using...

Embodiment 3

[0167] Example 3 Transformation of recombinant shuttle plasmid pPIC6αA / Pen Pichia pastoris X-33

[0168] 1. Linearization of recombinant shuttle plasmid pPIC6αA / Pen DNA:

[0169] Prepare a small amount of recombinant plasmid pPIC6αA / Pen DNA15-20μg, digest with RNaseA at 37°C for 30 min, and then use restriction endonuclease in a 60μL system Sac I perform enzyme digestion and linearization, keep warm in a water bath at 37°C for 4 hours, extract once with phenol:chloroform (25:24), extract once with chloroform:isoamyl alcohol (24:1), add 0.1 volume of 3M acetic acid Sodium (pH5.2), 2.5 times the volume of absolute ethanol, mix well and place at -20°C to precipitate overnight, centrifuge at 4°C, 12000rpm for 20min, discard the supernatant, wash twice with 75% ethanol prepared with ultrapure water, After drying naturally, dissolve the precipitate with 5-10 μL TE solution, and store at -20°C for later use. restriction endonuclease Sac I digestion of the linearized vector pl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombined litopenaeus setiferus protein SF-P9, a preparation method thereof and an application thereof. Besides the invention also relates to coding of an amino acid sequence of the recombined litopenaeus setiferus protein SF-P9 and a DNA sequence corresponding to the amino acid sequence, a yeast recombination gene engineering bacterial strain Pichia pastoris X-33 / pPIC6alpha / Pen with a preservation code of CCTCC No: M209126, as well as the utilization of the engineering bacterial strain to express the recombined litopenaeus setiferus protein SF-P9. Moreover, the invention also discloses a litopenaeus setiferus protein F-P6, a preparation method and an application thereof. Besides, the coding of an amino acid sequence of the litopenaeus setiferus protein Pen6 and a DNA sequence corresponding to the amino acid sequence is also disclosed in the invention. The recombined litopenaeus setiferus protein SF-P9 has enterokinase sites. After the process of enterokinase cutting on the litopenaeus setiferus protein SF-P9, the litopenaeus setiferus protein F-P6 is obtained. The litopenaeus setiferus protein SF-P9 and the litopenaeus setiferus protein F-P6 have obvious biological activities of antibacterial infection, antimycotics infection, and anti-virus infection, as well as have an obvious effect of inhibiting tumor cell growth. Besides, the litopenaeus setiferus protein SF-P9 and the litopenaeus setiferus protein F-P6 can be applied to prepare medicaments for treating or preventing bacteria infection, fungi infection and virus infection and to prepare antitumor drugs.

Description

technical field [0001] The invention relates to the fields of genetic engineering technology, medicine, and prevention and control of animal and plant diseases. More specifically, it relates to a recombinant genetically engineered strain containing the prawn peptide gene penaeidine Pichia pastoris X-33 / pPIC6αA / Pen, a recombinant prawn protein SF-P9 amino acid sequence and its corresponding DNA sequence, a prawn protein F-P6 amino acid sequence and its corresponding DNA sequence, and a prawn protein containing SF-P9 and the pharmaceutical composition of F-P6. At the same time, it also involves a yeast recombinant gene engineering strain expressing recombinant shrimp protein SF-P9 Pichia pastoris The construction method of X-33 / pPIC6αA / Pen, the prawn protein SF-P9 and F-P6 involved in the present invention have obvious biological activity against Gram-positive bacteria, Gram-negative bacterial infection, and anti-fungal infection activity And the biological activity of anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/435C12N15/12C12N1/19C12N15/09A61K38/17A61P31/04A61P31/10A61P31/12A61P35/02
Inventor徐进平孟小林王健唐检秀
OwnerHUBEI TAIYANGHONG BIOLOGICAL TECH CO LTD