Plant expression vector of arabidopsis heat shock factor gene AtHsfA1d, and application thereof

A plant expression vector and heat shock factor technology, applied in the field of plant genetic engineering, can solve the problems of slow detoxification rate and decreased ability of formaldehyde

Inactive Publication Date: 2012-02-29
KUNMING UNIV OF SCI & TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Arabidopsis overexpressing this enzyme increased the uptake efficiency of exogenous formaldehyde by 25%, and plants with reduced FALDH levels (due to co...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector of arabidopsis heat shock factor gene AtHsfA1d, and application thereof
  • Plant expression vector of arabidopsis heat shock factor gene AtHsfA1d, and application thereof
  • Plant expression vector of arabidopsis heat shock factor gene AtHsfA1d, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1: AtHsfA1d PCR Amplification and TA Cloning of Gene cDNA

[0057] Find Arabidopsis from GenBank AtHsfA1d cDNA sequence of the gene, and design a pair of primers with the following sequence:

[0058] Upstream primer 5'CG GAATTC ATGGATGTGAGCAAAGTAACCACAAG3'( Eco RI);

[0059] Downstream primer 5'GC CTCGAG TCAAGGATTTTGCCTTGAGAGATCTAAGG3'( xho I)

[0060] Add the GAATTC characteristic sequence to the 5' end of the upstream primer, and thus form Eco RI restriction site; the 3' end of the downstream primer is added xho Ⅰ Restriction site, using Arabidopsis first-strand cDNA as a template to amplify, to obtain AtHsfA1d The full-length cDNA of the gene.

[0061] Using TRIzoL Reagent (Invitrogen) from Arabidopsis ( Arabidopsis thaliana ) to extract total RNA from seedlings, take about 0.1g of plant tender leaves, add 1ml of TRIzoL extract, grind in a mortar, let stand at room temperature for 5min, then transfer to a centrifuge tube, then add 0.2ml...

Embodiment 2

[0063] Example 2: Construction of entry vector pENTR2B- wxya

[0064] use xho I and Eco RI double digestion pMD18-T- AtHsfA1d and pENTR2B-ccdB ( image 3 ), separated the cut vector and insert by agarose gel electrophoresis, and recovered pMD18-T- AtHsfA1d produced after being cut AtHsfA1d The cDNA fragment (1.4kb) of the gene and pENTR2B-ccdB were cut to generate the vector fragment pENTR2B, and then the ligase kit of TaKaRa was used to connect pENTR2B and AtHsfA1d The cDNA fragment of the gene generates the entry vector pENTR2B- AtHsfA1d ( image 3 ). Conversion of high efficiencies (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), at 37 oC Cultivate overnight, screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, and select the successfully connected plasmid ve...

Embodiment 3

[0065] Embodiment 3: Plant expression vector pK 2 -35S- At wxya build

[0066] Through the LR response of Gateway technology, the AtHsfA1d Subcloned into the plant expression vector pK2GW7 (the destination vector of Gateway, Belgium VIB / Gent company) ( Figure 5 ). The specific method is: use the plasmid extraction kit to purify Gateway's target vector pK2GW7, add pENTR2B- AtHsfA1d and pK2GW7 each 150ng, 1μl LR Clonase II Enzyme Mix (Invitrogen), mix well at 25 oC Reacted overnight, through the action of integrase AtHsfA1d Integrate into pK2GW7 to obtain AtHsfA1d The plant expression vector plasmid pK 2 -35S- AtHsfA1d ( Figure 5 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with spectinomycin (Spe, 50 μg / ml), at 37 oC Cultivate overnight, and screen Spe-resistant recombinant colonies. Extract the pl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plant expression vector of an arabidopsis heat shock factor gene AtHsfA1d, and the application thereof, belonging to the field of genetic engineering. According to the invention, the plant expression vector pK2-35S-AtHsfA1d is constructed by the arabidopsis heat shock factor gene AtHsfA1d, and is transferred into the plant via Agrobacterium mediation, so that the absorption capacity and the tolerance of the plant to the methanal are improved, and own defects of low absorption capacity and low tolerance to the methanal of the plant are solved; the experimental resultsshow that, after being cultred for 7 days in a MS solid culture medium containing 6mmol/L methanal, the transgenic tobacco with over-expression of an AtHsfA1d transcription factor has greater fresh weight than that of the wild tobacco, and the methanal absorption speed of the plant of the transgenic AtHsfA1d tobacco in 4mM methanal is higher than that of the wild tobacco.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular to Arabidopsis heat shock factor gene AtHsfA1d The plant expression vector and its application in the preparation of transgenic plants with enhanced ability to absorb formaldehyde. Background technique [0002] Formaldehyde is a colorless gas with a strong pungent odor, easily soluble in water, alcohol and ether. It has a very strong reaction ability and can produce non-specific reactions with proteins, nucleic acids and lipids (Feldman et al., Prog Nucleic Acid Res Mol Biol, 1973, 13:1-49), and is a very active compound, so it is effective for all All organisms are highly toxic. Formaldehyde is widely used in industrial production as a raw material for the manufacture of resins, adhesives, paints, plastics, and man-made fibers, and is the most widely used chemical raw material in the adhesive industry. With the development of the economy and the improvement of people's l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N15/29A01H5/00
Inventor 陈丽梅张道君年洪娟李昆志
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products