Plant expression vector of arabidopsis heat shock factor gene AtHsfA1d, and application thereof
A plant expression vector and heat shock factor technology, applied in the field of plant genetic engineering, can solve the problems of slow detoxification rate and decreased ability of formaldehyde
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1: AtHsfA1d PCR Amplification and TA Cloning of Gene cDNA
[0057] Find Arabidopsis from GenBank AtHsfA1d cDNA sequence of the gene, and design a pair of primers with the following sequence:
[0058] Upstream primer 5'CG GAATTC ATGGATGTGAGCAAAGTAACCACAAG3'( Eco RI);
[0059] Downstream primer 5'GC CTCGAG TCAAGGATTTTGCCTTGAGAGATCTAAGG3'( xho I)
[0060] Add the GAATTC characteristic sequence to the 5' end of the upstream primer, and thus form Eco RI restriction site; the 3' end of the downstream primer is added xho Ⅰ Restriction site, using Arabidopsis first-strand cDNA as a template to amplify, to obtain AtHsfA1d The full-length cDNA of the gene.
[0061] Using TRIzoL Reagent (Invitrogen) from Arabidopsis ( Arabidopsis thaliana ) to extract total RNA from seedlings, take about 0.1g of plant tender leaves, add 1ml of TRIzoL extract, grind in a mortar, let stand at room temperature for 5min, then transfer to a centrifuge tube, then add 0.2ml...
Embodiment 2
[0063] Example 2: Construction of entry vector pENTR2B- wxya
[0064] use xho I and Eco RI double digestion pMD18-T- AtHsfA1d and pENTR2B-ccdB ( image 3 ), separated the cut vector and insert by agarose gel electrophoresis, and recovered pMD18-T- AtHsfA1d produced after being cut AtHsfA1d The cDNA fragment (1.4kb) of the gene and pENTR2B-ccdB were cut to generate the vector fragment pENTR2B, and then the ligase kit of TaKaRa was used to connect pENTR2B and AtHsfA1d The cDNA fragment of the gene generates the entry vector pENTR2B- AtHsfA1d ( image 3 ). Conversion of high efficiencies (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), at 37 oC Cultivate overnight, screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, and select the successfully connected plasmid ve...
Embodiment 3
[0065] Embodiment 3: Plant expression vector pK 2 -35S- At wxya build
[0066] Through the LR response of Gateway technology, the AtHsfA1d Subcloned into the plant expression vector pK2GW7 (the destination vector of Gateway, Belgium VIB / Gent company) ( Figure 5 ). The specific method is: use the plasmid extraction kit to purify Gateway's target vector pK2GW7, add pENTR2B- AtHsfA1d and pK2GW7 each 150ng, 1μl LR Clonase II Enzyme Mix (Invitrogen), mix well at 25 oC Reacted overnight, through the action of integrase AtHsfA1d Integrate into pK2GW7 to obtain AtHsfA1d The plant expression vector plasmid pK 2 -35S- AtHsfA1d ( Figure 5 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with spectinomycin (Spe, 50 μg / ml), at 37 oC Cultivate overnight, and screen Spe-resistant recombinant colonies. Extract the pl...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
