Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit

A real-time fluorescence quantification and detection kit technology, applied in the biological field, can solve the problems of cumbersome operation, time-consuming, low sensitivity, etc., achieve the effect of unifying efficiency and technology, improving efficiency and time, and saving production costs

Inactive Publication Date: 2012-03-07
ZHEJIANG UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Hand, foot and mouth disease caused by the two is difficult to distinguish clinically
Traditional enterovirus detection includes virus isolation and culture and serological diagnosis. The former was once regarded as the "gold standard" for enterovirus diagnosis, but the operation is cumbersome and time-consuming, generally takes 4-15 days, and there are cumbersome and sensitive operations. It is far from meeting the "four early" requirements of disease prevention; and the most commonly used serological diagnosis is the neutralization test, that is, the microplate method is used to determine the antibody titer, and the titer of the serum in the acute phase and the serum in the convalescent phase are usually used for testing. In comparison, a 4-fold or more increase in antibody titers proves viral infection
However, it can only be used as a basis for retrospective diagnosis, and it is easy to cross-react with other viruses, so the antibody method is not helpful for early diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit
  • Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit
  • Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] see figure 1 , the present invention provides a triplex real-time fluorescent quantitative RT-PCR detection kit for enterovirus, the reagent is composed of quantitative RT-PCR reaction solution 1, standard substance 2, positive control substance 3, negative control substance 4 and box body 5, Wherein quantitative RT-PCR reaction solution 1 contains RT-PCR buffer, MgCl 2 , dNTPs, EV universal primers, EV universal fluorescent probes, EV71 fluorescent probes, CA16 fluorescent probes, thermostable DNA polymerase (Taq DNA polymerase), reverse transcriptase (PrimeScript RTase enzyme).

[0035] Detection primers are divided into upstream primers and downstream primers:

[0036] The upstream primer sequence is: 5`- CCCTGAATGCGGCTAATCC -3`

[0037] The downstream primer sequence is: 5`- GATTGTCACCATAAGCAGCC -3`

[0038]Detection with each typing fluorescent probe sequence and respective fluorescein label:

[0039] EV universal fluorescent probe is: 5`FAM--ACACGGACACCCAAAGT...

Embodiment 2

[0046] Example 2 Sensitivity and specificity experiment of enterovirus triple real-time fluorescent quantitative RT-PCR detection kit

[0047] 1. Materials:

[0048] The selected pathogenic microorganisms include the following: experimental group: coxsackievirus A group type 16, enterovirus EV71 type, coxsackievirus group B type 3 and echovirus type 30 and other enterovirus strains; control group: hepatitis A Viruses, rotavirus, beta virus, human cytomegalovirus and mycoplasma pneumoniae, etc., the above virus strains were purchased from Sun Yat-sen University Da'an Gene Company.

[0049] 2. Primer and probe design and synthesis:

[0050] Bioinformatic analysis of the nucleic acid sequence in the UTR region of enteroviruses, using software such as DNA STAR to analyze the sequence homology and differences of each type, designing and screening EV universal primers, EV universal fluorescent probes, EV71 fluorescent probes, etc. Needle, CA16 fluorescent probe.

[0051] The u...

Embodiment 3

[0061] Example 3 Application of Enterovirus Triple Real-Time Fluorescent Quantitative RT-PCR Detection Kit in Clinical Sample Detection

[0062] 1. Specimen testing:

[0063] During the epidemic period of HFMD from May 2010 to October 2010, 192 stool samples and 215 throat swab samples from outpatients and inpatients in our hospital with suspected HFMD were selected. The Enterovirus Universal Nucleic Acid Detection Kit, EV71 Nucleic Acid Detection Kit and CA16 Nucleic Acid Detection Kit provided by Sun Yat-Sen University Daan Gene Co., Ltd. and registered and approved by the State Food and Drug Administration were selected as controls. To evaluate the performance index of the application kit.

[0064] 2. Clinical sample control test results:

[0065] The results of 192 cases of stool samples and 215 cases of throat swab samples of enterovirus triple real-time fluorescent quantitative RT-PCR detection kit and single triple tube control reagent produced by Daan Company are sho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an enterovirus triple real-time fluorescent quantitative RT-PCR detection kit, which comprises a quantitative RT-PCR reaction solution, a standard substance and a reference substance, wherein, the quantitative RT-PCR reaction solution comprises a RT-PCR buffer solution, MgCl2, dNTPs, an EV universal primer, an EV universal fluorescent probe, an EV71 type fluorescent probe, a CA16 type fluorescent probe, heat resistant DNA polymerase and reverse transcriptase. The kit of the invention enables detection and genotyping to enterovirus universal type, enterovirus 71 type andcoxsackie virus group A 16 type by a one-step method. Compared with the current single detection kit, the kit of the invention is capable of saving the production cost and detection cost, raising theefficiency and time of the detection. Under the condition of ensuring no competition of multiple primers, the purpose of multi-channel detection can be achieved, so that the unification of the efficiency and technology is achieved.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a fluorescent quantitative RT-PCR detection kit, in particular to a three-probe real-time fluorescent quantitative RT-PCR for detection of enteroviruses in children's feces, pharynx, blood, cerebrospinal fluid and other samples. (EV), enterovirus type 71 (EV71), and coxsackievirus A16 (CA16) typing and quantification. This product takes the highly conserved 5' non-coding region (UTR) of enteroviruses as the target sequence, and designs enterovirus general primers and three-color fluorescent markers for enterovirus general type, enterovirus 71 and coxsackie virus A16 The probe uses one-step three-color real-time fluorescent quantitative RT-PCR technology to achieve the application purpose of early, rapid and accurate detection and typing of all enteroviruses. Background technique [0002] Hand-foot-mouth disease (HFMD) is a common infectious disease caused by a variety of enter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor吴亦栋尚世强杜立中陈志敏
OwnerZHEJIANG UNIV