Triticum aestivum Mevalonate kinase gene TaMVK, and separation cloning and enzymatic activity determination method thereof

A wheat mevalonate kinase, mevalonate kinase technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc.

Inactive Publication Date: 2012-03-28
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mevalol has been isolated and cloned from Arabidopsis thaliana, rice (Oryza sativa), corn (Zea mays), sorghum (Sorghumbicolor), rubber (Hevea brasiliensis), castor (Ricinus communis) and other plants Acid kinase gene, but there is no precedent for isolating mevalonate kinase gene from wheat varieties successfully in the prior art, thus restricting the application of cloning mevalonate kinase gene in wheat production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triticum aestivum Mevalonate kinase gene TaMVK, and separation cloning and enzymatic activity determination method thereof
  • Triticum aestivum Mevalonate kinase gene TaMVK, and separation cloning and enzymatic activity determination method thereof
  • Triticum aestivum Mevalonate kinase gene TaMVK, and separation cloning and enzymatic activity determination method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1 (wheat leaf RNA extracts)

[0056] (1) The wheat variety Yumai was grown to the three-leaf stage in a constant temperature incubator (28° C.) with vermiculite.

[0057] (2) Grind the leaves into powder in liquid nitrogen, and transfer them to DEPC-treated EP tubes.

[0058] (3) Add appropriate amount of RNAiso Plus.

[0059] (4) Stand at room temperature for 5 minutes.

[0060] (5) Add 1 / 5 volume of RNAiso Plus in chloroform. Shake until creamy.

[0061] (6) Stand at room temperature for 5 minutes.

[0062] (7) Centrifuge at 12000g for 15 minutes at 4°C.

[0063] (8) Transfer the supernatant to a new DEPC-treated EP tube, add isopropanol equal to the volume of the supernatant, and mix well. Stand at room temperature for 10 minutes.

[0064] (9) Centrifuge at 12000g for 10 minutes at 4°C.

[0065] (10) Add 1 mL of 75% ethanol prepared with DEPC water to the precipitate. Centrifuge at 12000g for 5min at 4°C.

[0066] (11) Keep the precipitate and dr...

Embodiment 2

[0068] Example 2 (synthesis of the first strand of cDNA)

[0069] (1) Add in sequence to the DEPC-treated PCR tube:

[0070]

[0071] (2) Run on a PCR machine; 65°C for 5 minutes and then quenched on ice.

[0072] (3) Add to the PCR tube:

[0073]

[0074] (4) Carry out on PCR instrument: 42°C for 60min, 70°C for 15min

Embodiment 3

[0075] Embodiment 3 (intermediate sequence amplification)

[0076] 1 Primer design for intermediate sequences

[0077] Using Primer5.0 primer design software and DNAMAN software, primers were designed according to part of wheat mevalonate kinase EST sequence.

[0078] The upstream primer is: WmvkF: 5′GTTGGCGGAACGGAGTGGCA 3′ (Seq ID No: 3)

[0079] The downstream primer is: WmvkR: 5'CGACTTTGAAGCAGCGGAAACCAT3' (Seq ID No: 4)

[0080] The PCR system is: water 9.3 μL, 10x PCR buffer 1.5 μL, dNTP 0.7 μL, P10.6 μL, P2 0.6 μL, LATag 0.3 μL.

[0081] The PCR program is: 94°C for 5 min, 94°C for 45 s, 68°C for 45 s, 72°C for 90 s, 72°C for 10 min, 32 cycles.

[0082] 2 PCR result detection of intermediate sequence

[0083] Mix 8 μL of PCR amplification product with 1 μL of bromophenol blue, point it into 1.5% agarose gel, electrophoresis at 120V for 45 minutes, observe and take pictures with an ultraviolet gel imaging system, such as figure 2 Shown to check whether the target fra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention which belongs to the molecular biological field relates to a technology of key enzymatic gene Triticum aestivum Mevalonate kinase gene TaMVK separation cloning, enzymatic protein prokaryotic expression, enzymatic protein separation purifying, and in vitro detection of the enzymatic activity, wherein the TaMVK is obtained from a Triticum aestivum species Zea mays, and can be synthesized with isoprenoid substances of Triticum aestivum chlorophyll, carotenoid, cytokinin, abscisic acid, gibberellin, dolichol, terpenoids, coenzyme Q, sterol, phytotoxin and the like. An important technological reserve is provided for further constructing an eukaryotic gene expression vector of the Mevalonate kinase gene, converting corresponding crops, especially plants which depend on secondary metabolism to obtain important business values, and discussing relationships of the overexpression of the Mevalonate kinase gene in acceptor plants with important agronomic properties of secondary metabolic products, the grain size, the grain weight, and the like, thereby improving the crop output, dissecting structures of the intron, the exon and the promoter of the Mevalonate kinase gene, researching functions of the promoter, and developing a relevant molecular mark.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to a kind of wheat chlorophyll, carotenoid, cytokinin, abscisic acid, gibberellin, terpene alcohol, terpenoid, coenzyme Q, sterol obtained from wheat variety Yumai Isolation and cloning of the key enzyme gene mevalonate kinase gene TaMVK synthesized with plant toxins and other isoprenoid substances, prokaryotic expression of enzyme protein, separation and purification of enzyme protein and in vitro detection technology of enzyme activity. Background technique [0002] Isoprenoid substances exist in all organisms, especially in plants, and are important organic substances necessary for maintaining plant growth and development, photosynthesis, etc. At present, more than 30,000 plant isoprenoids have been discovered, and this number is still increasing year by year. Such substances have various roles in organisms, and can be used as photosynthetic pigments (such as chlorophyll, caroteno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00
Inventor楚秀生王宝莲樊庆琦李玉莲李永波黄承彦刘爱峰高洁隋新霞
OwnerCROP RES INST SHANDONG ACAD OF AGRI SCI