Parathyroid hormone (PTH) derivative

A parathyroid hormone and derivative technology, applied in the fields of parathyroid hormone, hormone peptides, drug combinations, etc., can solve the problem of incomplete understanding of biological functions, improve compliance and therapeutic effect, and reduce the frequency of dosing , the effect of prolonging the half-life

Active Publication Date: 2012-04-04
CHENGDU JINKAI BIOTECH CO LTD +1
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The function of human serum albumin may be multifaceted, but its detailed biological function is not fully understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Parathyroid hormone (PTH) derivative
  • Parathyroid hormone (PTH) derivative
  • Parathyroid hormone (PTH) derivative

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Using the pTDa expression plasmid to synthesize the sequence in SLD32 Escherichia coli strain is

[0038] Parathyroid hormone analogue of N'-SerValSerGluIleGlnLeuMetHisAsnLeuGlyArgHisLeuAsnSerMetGluArgValGluTrpLeuArgLysArgLeuGlnAspValHisAsnPhe-C'

[0039] (Arg 13,27 -PTH 1-34 )

[0040] (SEQ ID NO: 1)

[0041] 1a Construction of engineered bacteria

[0042] E. coli preferred codons were selected and the following cDNA sequences were designed considering the possible secondary structure to obtain high expression in the expression plasmid (pTDa):

[0043] 5’-gaattcctggttccgcgttctgtatctgaaatccaactgatgcacaacctgggtcgccacctgaactctatggaacgtgtagaatggctgcgtaaacgcctgcaggatgtacacaacttctaagtcgac-3’

[0044] (SEQ ID NO: 2)

[0045] Designed Arg 13,27 -PTH 1-34 The coding gene fragment was artificially synthesized by the full sequence of Shanghai Jikang Bioengineering Co., Ltd., and loaded into the cloning vector pUC18 with EcoRI and SalI sites for preservation (pU...

Embodiment 2

[0073] Arg 13,27 Lys 26 [N-ε-(γ-Glu(N-hexadecanoyl))]-PTH 1-34 preparation of

[0074] At 0-5°C, the Arg 13,27 -PTH 1-34 4.1g (about 0.1mmol) was dissolved in 40ml of water. The pH of the solution was adjusted to 11.5 by adding 1.0M sodium hydroxide solution (3.5ml). After 5 minutes, N-methyl-2-pyrrolidone (60ml) and 1.0M acetic acid (1.5ml) were added and the temperature was maintained at 15°C . Triethylamine (0.3ml) was added followed by N-hexadecanoylglutamic acid gamma-N-hydroxysuccinimidate (146mg, 0.30mmol). After standing at 15° C. for 50 minutes, water (60 ml) was added, and 1.0 M acetic acid (2.10 ml) was added to adjust the pH of the solution to 8.5.

[0075] Yield: By analytical RP-HPLC, it was shown that the reaction mixture contained 73% (peak area) Arg 13,27 Lys 26 [N-ε-(γ-Glu(N-hexadecanoyl))]-PTH 1-34 .

[0076] The final purified product was obtained by preparative column chromatography. Dissolve the crude peptide in 90% acetonitrile aqueous soluti...

Embodiment 3

[0080] Arg 13,27 Lys 26 [N-ε-(γ-Glu-OMe(N-hexadecanoyl))]-PTH 1-34 preparation of

[0081] Under reaction conditions similar to Example 2, Arg was acylated using N-hexadecanoyl glutamate α-methyl ester γ-N-hydroxysuccinimidate 13,27 -PTH 1-34 .

[0082] Yield: By analytical RP-HPLC, it was shown that the reaction mixture contained 65% (peak area) Arg 13,27 Lys 26 [N-ε-(γ-Glu-OMe(N-hexadecanoyl))]-PTH 1-34 .

[0083] The final purified product was obtained by preparative column chromatography.

[0084] Yield: 1.4g

[0085] Molecular weight of the title compound determined by electrospray mass spectrometry: 4460 (theoretical: 4461)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a parathyroid hormone (PTH) derivative which has an amino acid sequence shown in SEQ ID NO: 1. With glutamic acid as a spacer, epsilon-amino of lysine at the 26-th position is connected with a lipophilic group W which has 12-40 carbon atoms and selectively contains a group capable of carrying negative charges so as to finally obtain the PTH derivative. Compared with PTH, the derivative has longer in vivo half-life period; therefore, the PTH administration frequency can be reduced, and compliance and treatment effect of medicines can be improved.

Description

technical field [0001] The present invention relates to a novel parathyroid hormone derivative, a preparation method of the derivative, a pharmaceutical composition containing the derivative and an application of the parathyroid hormone derivative in the treatment of osteoporosis. Background technique [0002] Parathyroid hormone (PTH) is a single-chain polypeptide protein containing 84 amino acids secreted by the parathyroid gland. It is one of the most important peptide hormones regulating calcium and phosphorus metabolism and bone turnover. [0003] The physiological function of human parathyroid hormone (hPTH) is mainly to promote the osteogenesis of osteoblasts, stimulate the reabsorption of calcium by the kidney, the secretion of phosphorus and the reconstruction of bone. Studies have shown that the active center of hPTH is located in the N-terminal 1-34 amino acid peptide, and it plays its role by binding to specific receptors in kidney and bone tissues. PTH is a goo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/635A61K38/29A61P19/10
Inventor赵斌彭红卫杨伟张宝华董佳里谭枫于赵凯
OwnerCHENGDU JINKAI BIOTECH CO LTD