Screening on single chain antibody for resisting fusarium and application thereof

A single-chain antibody, fusarium technology, applied in the field of genetic engineering, can solve the problems of cumbersome, unsuitable for large-scale continuous operation, etc., and achieve the effect of low production cost, improved stability or affinity, and low cost

Inactive Publication Date: 2013-10-30
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection of Fusarium contamination in food crops and their products is mainly through the observation of the morphological characteristics of mycelia and spores after cultivation or molecular detection with the help of PCR technology, but these two detection methods require more complicated sample processing. The operation of the lock is not suitable for large-scale continuous operation, while the sample processing of the immunological detection method is simple, and the detection process can also be operated on a large scale and programmed, saving time and effort, and easy to promote and use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening on single chain antibody for resisting fusarium and application thereof
  • Screening on single chain antibody for resisting fusarium and application thereof
  • Screening on single chain antibody for resisting fusarium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Fusarium moniliforme cell wall protein (CWP) preparation

[0043] 1) Pick Fusarium verticillioides wh1-2 with an inoculation needle (this bacterial strain has been sent to the China Center for Type Culture Collection (CCTCC) in Wuhan University, Wuhan City, Hubei Province on October 28, 2010, and its preservation No.: CCTCC M 2010283), inoculated in 20ml CMC medium (ingredients: 0.75% (W / V) carboxymethyl cellulose ester, 0.05% (W / V) NH 4 NO 3 , 0.05% (W / V)KH 2 PO 4 , 0.025% (W / V) MgSO 4 ·7H 2 O, 0.05% (W / V) yeast powder), 28 ° C, 200 r / min shaking light culture for 3 days.

[0044] 2) Get 1ml of spore liquid and inoculate it into 160ml of Czapek medium (ingredients: 3% (W / V) sucrose, 0.3% (W / V) NaNO 3 , 0.1% (W / V)K 2 HPO 4 , 0.05% (W / V) MgSO 4 ·7H 2 O, 0.05% (W / V) KCl, 0.001% (W / V) FeSO 4 , pH 9.0), 28°C, 225r / min shaking and dark culture for 5-7 days.

[0045] 3) Filter the culture solution with 2 layers of sterilized gauze, wash with steriliz...

Embodiment 2

[0053] Example 2: Animal immunization

[0054] Leghorn hens (purchased from the chicken farm of Huazhong Agricultural University) were immunized with the prepared Fusarium moniliforme CWP 4 times with an interval of 14 days between each time. For the first time, 500 μl of immune antigen was mixed with 300 μl of Freund’s complete adjuvant for immunization, and for the last three times, 500 μl of immune antigen was mixed with 300 μl of Freund’s incomplete adjuvant for immunization. On the 5th day after the third immunization, the serum was collected from 1:10 3 Doubling diluted to 1:128×10 3 , with reference to Lin Qiaoai, Dong Haiyan editors, "Medical Immunology and Microbiology Experiment Guide", Zhejiang University Press, published in 2006 and introduced the indirect ELISA method to detect the level of antibodies in the serum of immunized chickens. The test results showed that the immunized chicken serum produced a higher antibody titer (dilution > 1:10 5 ).

Embodiment 3

[0055] Example 3: Extraction of immune chicken spleen RNA, mRNA purification and cDNA first-strand synthesis

[0056] 1) The chickens with higher antibody titers were immunized again, and the spleens of the immunized chickens were taken 7 days later.

[0057] 2) Using TRNzol-A + Total RNA extraction reagent (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., operated according to the instructions of the reagent) was used to extract total RNA from spleen.

[0058] 3) Purify the total RNA extracted in step 2) with an mRNA purification kit (purchased from QIAGEN, and operate according to the instructions of the kit).

[0059] 4) Use SuperScript TM III Reverse transcriptase (purchased from Invitrogen, operated according to the instructions of the enzyme) uses the purified mRNA obtained in step 3) as a template, and uses the specific primer chicVHM (CGGTGGGGGACATCTGAGTGGG) to reverse transcribe the heavy chain variable region (V H ) cDNA first strand; the light ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of gene engineering, in particular to screening on a single chain antibody for resisting fusarium and an application in the aspect of fusarium immunologic detection aspect. The screening is directly started from mice spleen cells immune to fusarium moniliforme cell wall proteins (CWP), and a single chain antibody gene library is built by the molecular cloning method and technology, and the phage display technology is used to screen and express ELISA identification and sequence determination, and finally a single chain antibody for resisting fusarium, which has a high affinity, and a coding gene of the antibody are obtained, wherein the antibody is called Fv-chiclF11. The single chain antibody can be directly applied in fusarium detection after a large amount of expression and purification in escherichia coli, comprising applications in detecting fusarium pollution for field crops, feed or food.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, specifically relates to the screening and application of an anti-fusarium single-chain antibody, and is related to antibody screening technology. Background technique [0002] Fusarium is a kind of non-obligate and non-host-specific pathogenic fungi that widely exist in the world, and it is easy to occur in food crops and their products during the growth and storage periods. Fusarium can infect wheat (Triticum aestivum), barley (Hordeum vulgare), oats (Avena sativa L.), corn (Zea mays L.), rice (Oryza sativa), rye (Secale cereale L.) and other grasses. Cereal crops cause diseases such as seed rot, seedling rot, stem rot and ear rot, which seriously affect the growth and development of crops and grain quality, resulting in serious economic losses. Fusarium can also produce a variety of mycotoxins after infecting crops, and different degrees of fusarium toxin contamination have been fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/14C12N15/11G01N33/569
Inventor 廖玉才李和平胡祖权张静柏
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap