Screening on single chain antibody for resisting fusarium and application thereof
A single-chain antibody, fusarium technology, applied in the field of genetic engineering, can solve the problems of cumbersome, unsuitable for large-scale continuous operation, etc., and achieve the effect of low production cost, improved stability or affinity, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: Fusarium moniliforme cell wall protein (CWP) preparation
[0043] 1) Pick Fusarium verticillioides wh1-2 with an inoculation needle (this bacterial strain has been sent to the China Center for Type Culture Collection (CCTCC) in Wuhan University, Wuhan City, Hubei Province on October 28, 2010, and its preservation No.: CCTCC M 2010283), inoculated in 20ml CMC medium (ingredients: 0.75% (W / V) carboxymethyl cellulose ester, 0.05% (W / V) NH 4 NO 3 , 0.05% (W / V)KH 2 PO 4 , 0.025% (W / V) MgSO 4 ·7H 2 O, 0.05% (W / V) yeast powder), 28 ° C, 200 r / min shaking light culture for 3 days.
[0044] 2) Get 1ml of spore liquid and inoculate it into 160ml of Czapek medium (ingredients: 3% (W / V) sucrose, 0.3% (W / V) NaNO 3 , 0.1% (W / V)K 2 HPO 4 , 0.05% (W / V) MgSO 4 ·7H 2 O, 0.05% (W / V) KCl, 0.001% (W / V) FeSO 4 , pH 9.0), 28°C, 225r / min shaking and dark culture for 5-7 days.
[0045] 3) Filter the culture solution with 2 layers of sterilized gauze, wash with steriliz...
Embodiment 2
[0053] Example 2: Animal immunization
[0054] Leghorn hens (purchased from the chicken farm of Huazhong Agricultural University) were immunized with the prepared Fusarium moniliforme CWP 4 times with an interval of 14 days between each time. For the first time, 500 μl of immune antigen was mixed with 300 μl of Freund’s complete adjuvant for immunization, and for the last three times, 500 μl of immune antigen was mixed with 300 μl of Freund’s incomplete adjuvant for immunization. On the 5th day after the third immunization, the serum was collected from 1:10 3 Doubling diluted to 1:128×10 3 , with reference to Lin Qiaoai, Dong Haiyan editors, "Medical Immunology and Microbiology Experiment Guide", Zhejiang University Press, published in 2006 and introduced the indirect ELISA method to detect the level of antibodies in the serum of immunized chickens. The test results showed that the immunized chicken serum produced a higher antibody titer (dilution > 1:10 5 ).
Embodiment 3
[0055] Example 3: Extraction of immune chicken spleen RNA, mRNA purification and cDNA first-strand synthesis
[0056] 1) The chickens with higher antibody titers were immunized again, and the spleens of the immunized chickens were taken 7 days later.
[0057] 2) Using TRNzol-A + Total RNA extraction reagent (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., operated according to the instructions of the reagent) was used to extract total RNA from spleen.
[0058] 3) Purify the total RNA extracted in step 2) with an mRNA purification kit (purchased from QIAGEN, and operate according to the instructions of the kit).
[0059] 4) Use SuperScript TM III Reverse transcriptase (purchased from Invitrogen, operated according to the instructions of the enzyme) uses the purified mRNA obtained in step 3) as a template, and uses the specific primer chicVHM (CGGTGGGGGACATCTGAGTGGG) to reverse transcribe the heavy chain variable region (V H ) cDNA first strand; the light ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap