Halogenase gene of streptomyces xinghaiensis and product thereof, biosynthesis cluster of product modified by halogenase gene

A technology of marine streptomyces and halogenase, which is applied in the field of genetic engineering, can solve the problems of difficulty, many chemical synthesis steps, poor solubility of complestatin, etc., and achieve the effect of low copy number and avoiding preference

Inactive Publication Date: 2012-07-04
DALIAN UNIV OF TECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the variety of unique biological activities of complestatin, it also attracts people to carry out chemical synthesis research, but its chemical synthesis was not reported until 2010, but the chemical synthesis has many steps and is difficult
In addition, the poor solubility of complestatin may also be a factor limiting its drug development, so the development of its analogues has important research significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Halogenase gene of streptomyces xinghaiensis and product thereof, biosynthesis cluster of product modified by halogenase gene
  • Halogenase gene of streptomyces xinghaiensis and product thereof, biosynthesis cluster of product modified by halogenase gene
  • Halogenase gene of streptomyces xinghaiensis and product thereof, biosynthesis cluster of product modified by halogenase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Isolation of the halogenase gene of Streptomyces marinum and the acquisition of its modified product gene cluster.

[0033] Extraction of marine Streptomyces genomic DNA:

[0034] Use TBS medium (in g / L, tryptone 17, soybean peptone 3, sodium chloride 3, glucose 2.5, dipotassium hydrogen phosphate 2.5, pH 7.5) at 28°C, 150rpm for 48 hours. Collect more than 10 ml of actinomycete cells, resuspend the cells in 5 ml of SET buffer, add an appropriate amount of 0.1 mm glass beads for vortexing. Digest with 1ml of 20mg / ml lysozyme at 37°C for more than 2h, then add 500 μl of 15mg / ml proteinase K, and react at 37°C for 30min. Then add 1 / 10 volume of 20% SDS solution and react at 55°C for 1h. Use 1 / 3 volume of 5 M NaCl solution, react at room temperature for 30 min, then add saturated phenol / chloroform at a volume ratio of 1:1, mix well, and react at room temperature for 30 min. Centrifuge at 8000 r / min at 4°C for 20 min, discard the protein precipitate, and add a...

Embodiment 2

[0058] Example 2: Analysis of sequencing results of gene clusters encoding Complestatin-like Compound in marine Streptomyces

[0059] Sequencing Results and Analysis of Halogenase from Streptomyces marinum

[0060] Halogenase gene sequence

[0061] > sin H SEQ ID NO. 1

[0062] ATGACCCGCCGGGTGACAAGGGGAGGAGGGATGGCCTTGCCGGATTCCGAGGAATTCGATGTGGTGGTCGTCGGTGGAGGGCCCGCCGGATCGACGCTGGCCGCGTTGACGGCCATGCAGGGACACCGGGTGCTGGTCCTGGAGAAGGAGTTCTTCCCCCGTCACCAGATCGGGGAGTCGCTCCTGCCGGCCACCGTGCACGGCGTGTGCCGGCTGACCGGCGTGGCGGACGAGCTCGCCGCCGCGGGCTTCCCGCGCAAGCGCGGCGGCACGTTCAAGTGGGGCGCCAACCCCGAGCCGTGGACCTTCTCCTTCTCCGTCTCCCCGCGCATGACCGGGCCGACGTCCTACGCCTACCAGGTCGAGCGGGCCAAGTTCGACGAGATCCTGCTCAACAACGCCCGCCGGGTGGGCGCCGAGGTGCGCGAGGGCTGTGCCGCCGTCGACGTCGTCGAGGACGGGGAGCGGGTCCGGGGCGTCCGGTACACCGACGCCGACGGCCGCGAGCACCGGGCGTCGGCCACGTTCGTCGTGGACGCCTCCGGCAACGGAAGCCGGCTGTACCGGCGGGTGGGCGGAACCCGGGAGTACTCGGAGTTCTTCCGCAGCCTGGCCCTGTACGGCTACTTCGAGGGCGGCAAGCGGCTGCCGGAACCGAACTCGGGCAACATCCTGTCGGTGGCGTTCGAGAGCGGCTGGTTCTGGTACA...

Embodiment 3

[0071] The gene and product thereof of embodiment 2 are detected and analyzed as follows:

[0072] (1) Sequence analysis of the halogenase-positive plasmid of the marine Streptomyces fosmid library:

[0073] Combining the halogenase-positive Fosmid plasmid sequencing results with the 454 and Solexa high-throughput sequencing of the aforementioned marine Streptomyces, the sequence was analyzed, and the DNA sequence analysis open reading frame (ORF) analysis was provided by the National Center for Bioinformatics of the United States. The ORF Finder function of the NLM (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). The DNA homology analysis was compared with various DNA databases using the worldwide Blast engine (http: / / www.ncbi.nlm.nih.gov / BLAST / ) provided by the National Center for Bioinformatics of the United States.

[0074] After annotating the 42.81kB sequencing information (Table 2) and S. lavendulae Complestatin gene clusters in the comparison ( image 3 ), it can be p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering, and discloses a nucleotide sequence of halogenase gene of marine streptomyce. The nucleotide sequence is characterized by comprising nucleic acid in a nucleotide sequence shown as SEQ ID NO.1, an amino acid sequence shown as SEQ ID NO.2, and nucleic acid which has 75 percent of sequence sameness with the nucleic acid in SEQ ID NO.1 and maintains functions of halogenase. A method for establishing a Fosmid genome library is adopted, the library is subjected to polymerase chain reaction (PCR) screening by a conserved probe for the halogenase gene, and new halogenase gene is obtained. Compared with the traditional SuperCos vector, the invention has the advantages that: restriction enzyme cutting is not adopted when the Fosmid library is constructed, the preference of restriction enzyme cutting sites is avoided, and the copy number is small, so the stability is higher. The Fosmid library is quickly screened through PCR, the overall length of the halogenase gene and a cluster where the halogenase gene is located are obtained successfully. The cluster comprises 11 protein synthesis genes, and the sequences of the genes have high homology with non-ribosomal peptide synthetase gene, regulator gene, transfer protein gene and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the marine streptomyces halogenase gene and its product, and also to the biosynthetic gene cluster of the halogenase modified product. Background technique [0002] marine Streptomyces ( Streptomyces xinghaiensis ) is a new species of marine streptomyces isolated and identified by Dalian University of Technology (a strain of marine streptomyces S187 with broad-spectrum antibacterial activity, Chinese invention patent 200710158478.7), which has good activity against drug-resistant Staphylococcus aureus MRSA strains At the same time, it also has good activity against Pseudomonas aeruginosa, Escherichia coli, Acinetobacter baumannii and Candida albicans, etc., and its anti-Pseudomonas aeruginosa activity is more prominent among all the isolated strains. The 16S rDNA sequence of marine Streptomyces and two standard strains with close relationship S. flavofuscus NRRL B-8036 T a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/10C12Q1/68C12Q1/25
Inventor赵心清杨天虹王玉梅陈亮宇
OwnerDALIAN UNIV OF TECH