Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food

A detection kit and technology for Vibrio parahaemolyticus, which are used in the detection of viable Vibrio parahaemolyticus in food, processed foods, and detection kits for Vibrio parahaemolyticus in food, can solve the problem that the accuracy of the detection results is very affected. Large, inability to distinguish between live bacteria and dead bacteria of Vibrio parahaemolyticus, and achieve the effect of consistent accuracy, high accuracy and convenient on-site application

Inactive Publication Date: 2012-08-22
武汉欣泰扬生物科技有限公司
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are detection kits and detection methods for Vibrio parahaemolyticus in the prior art, but in the actual use process, there is an inability to distinguish live bacteria and dead bacteria of Vibrio parahaemolyticus, which has a great impact on the accuracy of the detection results, and false positives often occur result

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food
  • Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food
  • Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: EMA-LAMP detection kit

[0030] A Vibrio parahaemolyticus EMA-LAMP detection kit, the kit includes the following components: 10× reaction buffer (200mM Tris-HCl, 100mM KCl, 10mM (NH 4 ) 2 SO 4 , 1.0% (mass volume ratio) Tritonx-100, pH 8.8), Bst DNA polymerase (New England Biolabs LTD), 10 mM dNTPs (New England Biolabs LTD), 100 mM MgSO 4 (New England Biolabs LTD), deionized water, primers (primer F3, primer B3, primer FIP, primer BIP, primer Loop-F, primer Loop-R), 1.5 mg / mL EMA (Sigma), 1000×SYBR Green I fluorescent dyes.

[0031] Table 1 Primer sequence list

[0032]

[0033] The above primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

Embodiment 2

[0034] Embodiment 2: EMA-LAMP detection kit detection method

[0035] A detection method for Vibrio parahaemolyticus viable bacteria in food, the detection method is divided into two cases, the first case is on-site rapid detection, and the second case is laboratory detection. It is suitable for on-site rapid detection. The main steps are divided into EMA processing samples, DNA template rapid extraction, EAM-LAMP amplification reaction, and method 3 in Example 2 is used to determine the detection results. The main steps applicable to laboratory detection include sample enrichment and culture, EMA treatment of samples, rapid extraction of DNA templates, and EAM-LAMP amplification reaction. Specific steps are as follows:

[0036] Sample enrichment culture: dried animal aquatic products, pickled raw animal aquatic products, ready-to-eat algae food, surimi products and other aquatic foods and aquatic condiments and other processed foods should be pre-enriched. That is, take 25g...

Embodiment 3

[0045] Embodiment 3: PCR detection test of Vibrio parahaemolyticus

[0046] According to the tlh gene sequence of Vibrio parahaemolyticus published in GenBank (Accession number: M36437), Primer 5 was used to design specific primers. The upstream primer is F1: AAAGCGGATTATGCAGAAGCACTG; the downstream primer F2 is: GCTACTTTCTAGCATTTTCTCTGC, and the amplified fragment size is about 450bp. The 20 μL amplification system includes: 2 μL 10× reaction solution, 1 μL DNA template, 1 μL (0.2 μM) of upstream and downstream primers, 2 μL dNTP mixture, 1 μL KOD-Plus Taq enzyme, 1 μL 25 mM MgSO 4 , 11 μL DNase / RNase-Free ddH 2 O. PCR reaction system: pre-denaturation at 94°C for 5 min, 30 cycles, each cycle at 94°C for 30s, 55°C for 30s, 68°C for 30s, and 68°C for 5min. The amplified products were separated by electrophoresis at 120V on a 2% (mass-to-volume ratio) agarose gel for 50 min, and the sample loading amount was 8 μL / sample hole.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection kit and a detection method for viable bacteria in vibrio parahaemolyticus in food. The kit comprises 10* reaction buffer, a Bst DNA polymerase, dNTPs, MgSO4, DNase / RNase-FreeddH2O, a primer F3, a primer B3, a primer FIP, a primer BIP, a primer Loop-F, a primer Loop-R, ethidium bromide monoazide and 100*SYBRGreenI fluorescent dyes. The detection method includes steps of inoculating animality aquatic products animals and products to sodium chloride alkaline peptone water for overnight suspension culture after preprocess of samples; adding the ethidium bromidemonoazide to overnight suspension culture, placing the overnight suspension culture in a dark place, and performing the whole photoexcitation process on ice; and extracting sample DNA by using a DNA rapid extracting method, namely boiling bacteria suspension processed by the ethidium bromide monoazide, performing centrifugation, taking supernatant after the centrifugation as a DNA template of a loop-mediated isothermal amplification reaction, and performing the loop-mediated isothermal amplification reaction. The detection kit and the detection method for viable bacteria in vibrio parahaemolyticus in food have the advantages of being rapid, efficient, high in accuracy and sensitivity, convenient to use on sites, and widely suitable for detection for food, sanitation, immigration and the like.

Description

technical field [0001] The invention belongs to the field of food detection, in particular to a detection kit for Vibrio parahaemolyticus viable bacteria in food, and also relates to a detection method for Vibrio parahaemolyticus viable bacteria in food. It is suitable for animal aquatic products, dried animal aquatic products, pickled and drunk raw animal aquatic products, instant algae food, surimi products and other aquatic food and aquatic condiments, and other processed foods. The invention is suitable for rapid detection of aquatic product breeding enterprises, aquatic product processing enterprises, supermarkets, farmers' markets, aquatic product wholesale markets and laboratory detection of relevant national functional detection institutions. Background technique [0002] Vibio parahemolyticus is widely distributed in rivers, oceans and tropical and temperate coastal areas, mainly parasitic on plankton, fish, shrimps, crabs, shellfish and other aquatic products, caus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/63
Inventor张毅
Owner武汉欣泰扬生物科技有限公司