Fusion protein containing neutralizing epitope gene of C-terminal of encephalitis-B E protein and vaccine containing fusion protein

A fusion protein and gene technology, applied in gene therapy, genetic engineering, plant gene improvement, etc., can solve problems such as poor retention ability and low vaccine virus titer, and achieve high production cost, easy return to strength, and rapid production Effect

Inactive Publication Date: 2012-09-19
SHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Aiming at the defects of low virus titer and poor retention ability of vaccines for treating porcine JE existing in the prior art, the present invention provides a fusion protein containing a C-terminal neutralizing epitope gene of JE protein and a vaccine thereof, The neutralizing antibody titer of the vaccine of the present invention is higher than that of the attenuated vaccine, which is sufficient to protect against the attack of the strong virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein containing neutralizing epitope gene of C-terminal of encephalitis-B E protein and vaccine containing fusion protein
  • Fusion protein containing neutralizing epitope gene of C-terminal of encephalitis-B E protein and vaccine containing fusion protein
  • Fusion protein containing neutralizing epitope gene of C-terminal of encephalitis-B E protein and vaccine containing fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of prokaryotic expression vectors pet-32a-epitope and pet-32a-epitope-hsp70

[0031] 1) The neutralizing epitope epitope at the C-terminus of the JE E protein is located at 373aa-399aa on the E protein, with a total of 27 amino acids, and the neutralizing epitope is artificially synthesized:

[0032] P1: 5'-aattcgaaatggaaccgccgttcggtgactcctacatcgttgttggtcgtggtgacaaacagatcaaccaccactggcacaaagctca-3' (SEQ ID NO: 7);

[0033] P2: 5'-agct tgagcttt gtg cc agt ggtggttgatctgtttgtcaccacgaccaacaacgatgtaggagtcaccgaac ggcggttcca ttt cg-3' (SEQ ID NO: 8);

[0034] P1 is the sense strand sequence, and P2 is the antisense strand sequence, both of which are synthesized by Yingjun Biotech. designed as figure 1 As shown, the gene sequence of the neutralizing epitope at the C-terminus of the synthetic JE protein is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

[0035] 2) The above neutralizing epitopes were cloned into the prokaryoti...

Embodiment 2

[0039] Example 2 Expression of pet-32a-epitope and pet-32a-epitope-hsp70 in Escherichia coli

[0040] Pick a single colony and shake it in LB liquid medium overnight at 37°C, then take the bacterial liquid at a ratio of 1:100 and add it to LB liquid medium, and set the induced empty vector control pET-32a(+) / BL21. 37 Shake culture at ℃ until the OD value is 0.4-0.6 (it takes about 2-3 hours), add IPTG to the final concentration of 0.4mM, shake at 37℃ for 3h, take 1ml of the above-mentioned culture bacteria, centrifuge to discard the supernatant, and use 100μl 1×SDS for precipitation -PAGE loading buffer (50mmol / LDTT at pH 6.8, 2% SDS, 0.1 bromophenol blue, 10% glycerol) resuspended, boiled at 100°C for 3min and then used for later use (such as Figure 4 and Figure 5 shown).

[0041] After the expression of pet-32a-epitope was induced by IPTG, the 24kDa protein band was seen by SDS-PAGE electrophoresis, which was slightly larger than the empty vector control (20kDa), and was...

Embodiment 3

[0042] Example 3 Purification and Western blot analysis of pet-32a-epitope and pet-32a-epitope-hsp70 recombinant proteins

[0043] Cultivate the Escherichia coli BL21 containing the recombinant plasmid in 50ml LB at 37°C, add ampicillin at a final concentration of 100ug / ml, and when the bacterial liquid is shaken until the OD600 is 0.6, add 1mMIPTG at a final concentration, continue shaking at 37°C for 14h, and the large intestine Bacteria were centrifuged at 6000rpm for 10min, washed twice with PBS, collected bacteria, suspended in PBS, ultrasonically disrupted, centrifuged at 10,000rpm for 20min, and the supernatant and precipitate were subjected to SDS-PAGE respectively to determine whether the protein was in the supernatant or Inclusion bodies, the obtained protein was then subjected to a Ni column.

[0044] 1. Electrotransfer

[0045] (1) Take the samples with specific bands in the above SDS-PAGE electrophoresis and perform SDS-PAGE again;

[0046] (2) After the electro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biological gene engineering, and aims to solve the technical problems that in the prior art, a vaccine for treating pig encephalitis B is low in virus titer and poor in holding capacity. The invention provides a fusion protein which consists of a neutralizing epitope gene of a C-terminal of an encephalitis-B E protein and an M.Thsp70 gene. The invention also provides a vector containing the fusion protein gene, a vaccine containing the fusion protein and the preparation method of the vector. The preparation method of the vector comprises the following steps of: firstly, synthesizing the neutralizing epitope gene of the C-terminal of the encephalitis-B E protein, and cloning the neutralizing epitope gene into a prokaryotic expression vector; secondly, amplifying by taking a genome of a bacillus tuberculosis H37Rv standard strain as a template to obtain the M.Thsp70 gene, and cloning the M.Thsp70 gene into the prokaryotic expression vector to obtain a fusion protein expression vector; and finally, purifying to obtain an expression protein for preparing the vaccine which is used for preventing the encephalitis B. The titer of the neutralizing antibody of the vaccine provided by the invention is higher than that of a lentogenic vaccine, and is easy to produce efficiently and quickly on a large scale.

Description

technical field [0001] The invention belongs to the field of biogenetic engineering, in particular to a fusion protein containing a C-terminal neutralizing epitope gene of Japanese encephalitis E protein and a vaccine thereof. Background technique [0002] Pigs are one of the main sources of JE infection, and they form a "mosquito, pig" cycle of transmission with mosquitoes. At the same time, Japanese encephalitis is also one of the major epidemic diseases that seriously endanger the pig industry. The disease causes abortion and stillbirth in pregnant sows, orchitis in boars, and death of piglets due to encephalitis, which directly affects the expansion of the number of pigs. Sustained high-yield development has caused huge economic losses, and greatly limited the export of meat products; in my country, the vaccine currently used for the treatment of pig JE is a attenuated vaccine cultivated on BHK cells, but the virus titer is low, The disadvantages such as poor retention ab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/40C12N15/62C12N15/63C12N1/15C12N1/19C12N1/21C07K14/18C07K19/00A61K39/12A61K48/00A61P31/14
Inventor葛菲菲王建刘佩红周锦萍刘健杨显超
OwnerSHANGHAI ANIMAL EPIDEMIC PREVENTION & CONTROL CENT