Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene

A starch branching enzyme and mutant gene technology, which is applied in the field of molecular genetics, can solve the problems of difficulty in improving the content of resistant starch in rice, being easily affected by the environment, and the complexity of the determination method, so as to achieve accurate and consistent phenotype determination results and speed up Breeding process, the effect of saving breeding costs

Active Publication Date: 2012-12-12
SHANGHAI ACAD OF AGRI SCI +1
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because the determination of resistant starch is not only time-consuming and costly, but also easily affected by the environment, and the complexity of the determination method, it has always been difficult to improve the content of resistant starch in rice.
[0005] In addition, there are few reports on the development and utilization of molecular markers closely linked to resistant starch content

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene
  • Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene
  • Mutant gene of rice starch branching enzyme SBE3 gene and application of mutant gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] (1) Jiangtangdao No.1 / Miryang 23 F 2 Population construction and phenotyping

[0045] In the summer of 2008, F 1 generation seeds. The female parent was processed by artificial clipping and emasculation. Hybrid F was planted in Hainan base in the winter of 2008 1 Generation to get F 2 Generation seeds, planted F in Shanghai Academy of Agricultural Sciences in the summer of 2009 2 generation. each F 2 Leaf extraction DNA was collected from individual plants for genotype analysis, and selfed seeds were harvested from individual plants for the determination of resistant starch content. The F2 generation was used to initially map the genes controlling the content of resistant starch, and a QTL related to the content of resistant starch was found in the interval of molecular markers RM13366 and RM6611 on chromosome 2, which could explain 60.4% of the variation in the content of resistant starch. Select heterozygous individual plants in this segment, and further fine-...

Embodiment 2

[0064] Example 2 Validation of Molecular Markers

[0065] 1 Materials and methods

[0066] 1.1 Materials

[0067] Jiangtangdao 1 / Miryang 23 Hybrid F 2 Generation of 178 individual plants.

[0068] PCR amplification primers:

[0069] PCR-SpeI F: ATGTGATGTGCTGGATTTGG SEQ ID NO. 3

[0070] PCR-SpeI R: TGTGGTTTTCATACCGTTCTTA SEQ ID NO. 4

[0071] 1.2 Method

[0072] Amplify F with primers 2Population sample DNA. The reaction system includes 2 μl 10×PCR buffer (100 mM Tris-HCl pH 8.0, 15 mM MgCl2, 500 mM KCl, 1% TritonX-100), 0.2 mM dNTPs, 0.2 μM upstream and downstream primers, 50-100 ng sample DNA and 0.625 U Taq enzyme.

[0073] The reaction program was: pre-denaturation at 94°C for 5 min, cycle (94°C for 30 s, 56°C for 30 s, 72°C for 1 min) 35 times, and finally extension at 72°C for 10 min. The PCR product was digested with SpeI (TaKaRa), and the digestion reaction system was 20 μl, including: 17.5 μl PCR product, 2 μl 10× M buffer, 0.5 μl SpeI. Digested at 37°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mutant gene of a rice starch branching enzyme SBE3 gene. The mutant gene has a basic group mutation of T--C in a position corresponding to the 105th position of the 16th exon of the rice starch branching enzyme SBE3 gene. The invention further provides a method for screening rice variety with high resistant starch content. The basic group mutation of the mutant gene can be served as a molecular marker to effectively detect Jiangtangdao 1 with high resistant starch content and derived varieties (lines) of Jiangtangdao 1, so that the selection efficiency of the new rice variety with high resistant starch content is greatly improved and the rice variety with high resistant starch content is obtained.

Description

technical field [0001] The present invention belongs to the field of molecular genetics. Specifically, the present invention relates to the mutation screening of the main gene with high resistant starch content in rice and the application of the mutation. Background technique [0002] The definition of European Resistant Starch Association (EURESTA), Resistant Starch (Resistant Starch, referred to as RS) refers to starch or starch degradation products that cannot be absorbed in the small intestine of healthy individuals. Resistant starch has many important physiological functions such as lowering blood sugar, lowering blood lipids and benefiting intestinal health. Studies have shown that RS cannot digest, absorb and provide glucose in the small intestine, but can be fermented by intestinal physiological bacteria in the large intestine to produce short chain fatty acids (SCFA) and gas. The discovery and research progress of RS is considered by the Food and Agriculture Organ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N9/44C12Q1/68C12Q1/34
Inventor朴钟泽杨瑞芳张建明白建江楼素芬
OwnerSHANGHAI ACAD OF AGRI SCI