Rice salt stress related gene SIDP364 and coding protein and application thereof
A salt stress and rice technology, applied in rice salt stress related gene SIDP364 and its encoded protein and its application field, can solve problems such as agricultural production loss, achieve the effects of increasing food production, improving resistance, and effectively utilizing saline-alkali land
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 The acquisition of rice salt stress-related gene SIDP364 and the construction of overexpression vector
[0036] A new gene family of unknown function, DUF1644, was identified from plants by bioinformatics analysis, which may play an important role in the stress response of rice as a new class of transcription factors. However, the relationship between DUF1644 family genes and stress resistance has not been reported yet. The gene SIDP364 is a member of the rice DUF1644 gene family.
[0037] According to the SIDP364 gene cDNA nucleic acid sequence, synthesize a pair of primers SIDP364-S and SIDP364-A:
[0038] SIDP364-S5'CACCATGGGTTCAGGAATGGTG3'
[0039] SIDP364-A5'CTAGTAGTATGAACGTCTGC3'
[0040] The TOPO cloning recognition site is introduced into the forward primer SIDP364-S, so that the gene DNA fragment can be cloned on the pENTR / D-TOPO vector by the TOPO cloning method.
[0041] Using the above primers and using the rice leaf cDNA as a template, PCR amp...
Embodiment 2
[0045] Example 2 Transformation of rice with rice salt stress-related gene SIDP364 gene overexpression vector and PCR detection and identification
[0046] Preparation of Agrobacterium suspension: Take 20 μL of Agrobacterium glycerol preservation solution containing pH7WG2-SIDP364 plasmid, inoculate it in 10 mL LB (containing 50 mg / L kanamycin and 50 mg / L rifampicin), and culture with shaking at 28 °C overnight. Collect the bacteria by centrifugation and resuspend with an appropriate volume of AAM culture medium to make the Agrobacterium suspension OD 600 The value is between 0.3 and 1, and finally add acetosyringone to make the final concentration reach 50mg / L.
[0047]Take the mature seeds of Taipei 309, after shelling, sterilize the surface with sodium hypochlorite solution (active chlorine is about 3%) with a volume ratio of 1 / 3, wash with sterile water for 2 to 5 times, and dry on sterile filter paper Afterwards, they were inoculated in the induction medium of NBD, and t...
Embodiment 3T1
[0055] Example 3 T1 generation SIDP364 gene overexpression SIDP364 gene expression in transgenic rice plants and analysis of its resistance to salt stress
[0056] Quantitative analysis of SIDP364 gene expression and identification of salt tolerance were carried out on two T1 generation overexpression transgenic plant lines and wild-type plants respectively. The seeds of T1 generation SIDP364 gene overexpression transgenic plants and wild-type rice seeds were sown respectively, and cultivated according to conventional cultivation methods. After the plants grew for two weeks, wild-type plants and two T1 generation SIDP364 gene overexpression Quantitative analysis of SIDP364 gene expression in transgenic plants. And identify the resistance of transgenic plants to salt stress.
[0057] The specific operation method is as follows:
[0058] An appropriate amount of leaves were taken from wild-type plants and SIDP364 gene overexpressed transgenic plants respectively, and total RNA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com