Corn ZmCIPK12 gene and applications thereof
A gene and maize technology, applied in the field of transgenic plants, can solve the problem that the function research of maize CIPK gene has not yet been applied, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Embodiment 1: Contain the construction of the expression vector of CIPK protein kinase gene
[0017] 1. Using the cDNA sequence of ZmCIPK12 in the present invention, design primers C12-F: ATGGACGCTACCCCGCCGTC, C12-R: CTAATCAGTATCAGAAGGTAT, and use corn cDNA as a template to amplify the ZmCIPK12 gene sequence. The amplification system is:
[0018]
[0019]
[0020] Denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, 35 cycles; extension at 72°C for 7 minutes. The PCR products were cryopreserved for later use.
[0021] 2. Use an ordinary agarose gel recovery kit to recover the PCR product, connect the recovered PCR product to the T vector, transform the ligated product into Escherichia coli competent cells DH5α, pick the positively transformed clone, extract the plasmid and send it for sequencing, and then determine it by sequencing Correct clones are used for subs...
Embodiment 2
[0023] Embodiment 2: Containing the transformation and screening of CIPK12 protein kinase gene
[0024] 1. The constructed ZmCIPK12 expression vector pBI121-CIPK12 was transformed into Agrobacterium GV3101.
[0025] 2. Transformation of wild type Arabidopsis thaliana by floral dipping method.
[0026] 3. Convert the T obtained after conversion 0 The generation seeds were vernalized for 3 days, and then directly sowed in nutrient soil for growth. After about two weeks of normal growth, spray T with 0.5‰ kanamycin 0 Transformed plants were screened from Arabidopsis thaliana.
[0027] 4. Since the expression vector pBI121-CIPK12 used has the NPTII gene resistant to kanamycin, it can be transferred into the plant along with the target gene during transformation, so most of the untransformed plants die after spraying kanamycin , while the transformed plants were still able to grow normally. The transformed plants were harvested separately according to different lines 1 generat...
Embodiment 3
[0030] Embodiment 3: Contain the transgenic plant nucleic acid PCR analysis of CIPK protein kinase gene
[0031] 1. Using the total DNA of the extracted positive plants as a template, use ZmCIPK12 gene primers for PCR amplification. The positive plants can amplify bands of 1.5 kb and 1.5 kb, while the false positive plants have no PCR products. Wild-type plants could not amplify the target band ( image 3 ).
[0032] 2. After harvesting the T2 generation seeds of each transgenic line, the seeds were disinfected with 0.5% NaClO. Then spot-planted on MS medium plates containing 0.5‰ kanamycin (about 40 seeds were needed for each transgenic line), and the wild type was used as a negative control.
[0033] 3. Three days after vernalization, place them in a light incubator at 22°C for growth, and observe the growth of the seedlings one week later. The wild type cannot survive in MS medium containing 0.5‰ kanamycin.
[0034] 4. T 2 Due to gene segregation and free combination i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More