Mycobacterium tuberculosis TB detection kit
A technology of Mycobacterium tuberculosis and detection kit, which is used in material excitation analysis, microbial determination/inspection, fluorescence/phosphorescence, etc., can solve the problem of low detection sensitivity, and achieve reliable experimental basis, high detection sensitivity and fast operation. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] This embodiment provides a specific Mycobacterium tuberculosis detection kit, which includes the following components:
[0024] ①Nucleic acid release agent: contains surfactin 0.1mM / L, potassium chloride 100mM / L, sodium dodecyl sulfonate (SDS) 0.1%, 0.1% ethanol and solvent TE buffer.
[0025] ②Internal standard (positive internal control): It is a recombinant of 97 base pairs of synthetic DNA sequence inserted into pUC18T vector, namely plasmid, with a concentration of 2.00E+05copies / ml, and its sequence is: 5'-GTGTCTGCGGCGTTTTATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGTCGTTGGTTCTTCTGACTGCCAGTGTGT -3'.
[0026] ③PCR reaction solution: including 5μl of 10×PCR reaction buffer, 0.2mmol / L dNTP, the upstream and downstream primers used for target polynucleotide amplification are 0.3μmol / L, and the probe used for target polynucleotide detection It is 0.3μmol / L, the upstream and downstream primers used for the amplification of internal standard fragments are both 0.3μmol / L, and the pro...
Embodiment 2
[0032] This example provides the operating steps of the kit described in Example 1 for detecting TB-DNA in unknown samples such as sputum:
[0033] 1. Reagent preparation
[0034] According to the quantity of test sample, TB negative control, TB positive control and TB quantitative reference A~D, take the corresponding amount of PCR reaction solution (38μl / person), enzyme mixture (2μl / person) and internal Mark 1.0μl / person and mix thoroughly to form PCR-mix. For example, when the sample to be tested is 3 persons, a total of 9 persons (the number of persons for the above four are 3, 1, 1, and 4) PCR-mix; reserve after short-term centrifugation.
[0035] 2. Nucleic acid extraction
[0036] Add 2 to 3 times the volume of 4% NaOH solution to the sample, shake and mix, and let it stand for 30 minutes to liquefy. Take 500μl of the liquefied sample in a 1.5ml centrifuge tube (to avoid aspiration of obvious solid impurities), centrifuge at 12000r / min for 3min, aspirate the supernatant; add ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap