Cimicifuga triterpenoid compound and application thereof
A technology for Cimicifuga triterpenoids and compounds, which is applied to Cimicifuga triterpenoids, the preparation of antitumor drugs or the application field of tumor personalized targeted medical technology, can solve the problems of few reports on plant compound screening and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Compound KY40 separation and extraction of
[0023] In September 2008, Yunnan cohosh was collected from Yangla Township, Daocheng County, Sichuan Province ( Cimicifuga yunnanensis 1.5Kg of the above-ground part sample, the plant species name was identified by researcher Qiu Minghua of Kunming Institute of Botany, and the crude drug specimens are deposited in the State Key Laboratory of Phytochemistry and Western Plant Resources Sustainable Utilization of Kunming Institute of Botany, Chinese Academy of Sciences (KUN No. 200809007).
[0024]Crush 1.5Kg of the aerial part of Cimicifuga yunnanensis, soak and extract with 95% methanol (5L) at room temperature for 3 times, each time for 1 day; combine the extracts, concentrate under reduced pressure at 50°C until no methanol is evaporated, and obtain 137.8g of extract ; The extract (137.8g) was mixed with 250g of silica gel, normal pressure forward silica gel (2000g) column chromatography, chloroform-methanol ...
Embodiment 2
[0034] Example 2: Antitumor Activity of Cimicifuga Triterpenoid KY40
[0035] 1. Construction of screening cells: wild-type mice were used as carriers, and p53 gene-deleted mouse embryonic fibroblasts (p53 - / - cells) to construct mouse tumor cells (p53 - / - +S+Ras, p53 - / - +V+Ras), the specific steps are as follows:
[0036] (1) Construction of vectors for Ras mutant genes and vectors expressing p53S mutant genes
[0037] For the construction method of the vector, see the method in patent ZL200910095184.3, that is, the p53S or Ras mutant gene cDNA is connected into the PQCXIP (purchased from Invitrogen) vector by conventional genetic engineering methods, and the p53S or Ras sequence constructed in the vector is sequenced For verification, the constructed vector is used in p53 - / - The p53S or Ras mutant gene is introduced into the cells.
[0038] (2) Transfection of p53S or Ras mutant gene vector
[0039] (a) Preparation of phoenix cells
[0040] The day before transf...
Embodiment 3
[0053] Embodiment 3: The experiment that compound activates tumor suppressor gene p16 activity
[0054] 1. The construction of p16-GFP-reporting vector, the specific method is as follows:
[0055] (1) The green fluorescent protein GFP reporter gene was excised from the pAcGFP1-N1 plasmid (purchased from Clontech) using BgLII and NotI double enzyme digestion, and the Luciferase reporter gene in pGL4.82 (purchased from Promega) was replaced to produce pGL4- GFP vector;
[0056] (2) Design primers for the promoter region of the p16 gene (5'GCTCGAGGATGAAAATTACCCTCC3', 5'GGATCTCTTTTCCTCGCGGAGAT3') to amplify the promoter sequence and connect it into the pGL4-GFP vector, thus obtaining a reporter vector fused with the p16 gene promoter and GFP -- ---p16-GFP-reporter vector.
[0057] 2. The reporter vector fused with the p16 gene promoter and GFP is transferred into mouse fibroblasts (MEF), the specific method is as follows:
[0058] (1) Extract the plasmid with the TIANGEN BIOT...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com