Genetically engineered bacterium for expressing solubility pig gamma-interferonPoIFN-gamma and construction method and application of genetically engineered bacterium
A technology of genetically engineered bacteria and interferon, applied in the field of genetic engineering, can solve the problems of low expression level, inactive inclusion bodies in products, complicated and tedious preparation process, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of genetically engineered bacteria expressing soluble porcine gamma-interferon
[0042] The first step: artificial synthesis of PoIFN-γ gene (SEQ ID NO.4)
[0043] Referring to the comprehensive factors such as Escherichia coli BL21 (DE3)'s preference for amino acid codons, base GC content, and mRNA secondary structure, the nucleotide sequence of natural porcine gamma-interferon is optimized. The amino acid sequence of gamma-interferon, and the porcine gamma-interferon mature peptide gene that can be expressed efficiently in Escherichia coli BL21 (DE3), its sequence (SEQ ID NO.1) is as follows:
[0044] CAGGCGCCGTTTTTTAAAGAAATTACCATTCTGAAAGATTATTTTAATGCGAGCACCAGCGATGTGCCGAATGGCGGCCCGCTGTTTCTGGAAATTCTGAAAAATTGGAAAGAAGAAAGCGATAAAAAAATTATTCAGAGCCAGATTGTGAGCTTTTATTTTAAATTTTTTGAAATTTTTAAAGATAATCAGGCGATTCAGCGCAGCATGGATGTGATTAAACAGGATATGTTTCAGCGCTTTCTGAATGGCAGCAGCGGCAAACTGAATGATTTTGAAAAACTGATTAAAATTCCGGTGGATAATCTGCAGATTCAGCGCAAAGCGATTAGCGAACTGATTAAAGTGAT...
Embodiment 2
[0050] Embodiment 2 prepares porcine gamma-interferon
[0051] The strain used in this example is: pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) co-expressed genetically engineered bacteria.
[0052] The formulation of the self-inducing medium used in this example is: glycerol 0.5% (v / v), tryptone 1% (w / v), yeast extract 0.5% (w / v), lactose 0.2% (w / v ), glucose 0.05% (w / v), NaCl 0.5% (w / v), Na 2 HPO 4 50mM, KH 2 PO 4 50mM, (NH 4 ) 2 SO 4 25mM, MgSO 4 2mM.
[0053] The specific process of culture and fermentation is as follows: first, the preserved strain pET-32a(+)-PoIFN-γ / pTf16-P araB -tig / BL21(DE3) was inoculated on the LB plate containing ampicillin and chloramphenicol, cultured overnight at 37°C, and then a single colony was picked from the plate and inoculated on an autoinduced plate containing ampicillin and chloramphenicol. In the culture medium, culture at 27° C. and 210 rpm for 18 hours, and collect the cells by centrifugation.
[0054] Preparation of porci...
Embodiment 3
[0064] Embodiment 3 comprises the preparation of the composition of porcine gamma-interferon
[0065] To prepare 0.9% (w / v) NaCl solution, take 1 mg of purified porcine gamma-interferon PoIFN-γ and dissolve it in 0.5 ml of NaCl solution; take another 50 mg of mannitol and dissolve it in 0.5 ml of NaCl solution; Composition of porcine γ-interferon PoIFN-γ and mannitol, which contains 1 mg / ml of PoIFN-γ and 50 mg / ml of mannitol.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap