Anti-sterigmatocystin monoclonal antibody
A technology of Aspergillus versicolor and monoclonal antibody, applied in antifungal/algal/lichen immunoglobulins, measuring devices, instruments, etc., can solve the problems of consumer health threat, potential toxicity, and difficulty in identification, etc. The effect of fast inspection, stable inspection data and large inspection capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Construction of Anti-Varistoxin Monoclonal Antibody Hybridoma Cell Line
[0044] 1. Materials
[0045] 20% fetal bovine serum: product of Beijing Yuanheng Shengma Institute of Biotechnology; serum-free RPMI1640: product of Gibco; SP2 / 0 cells: imported from ATCC; Freund's complete adjuvant and Freund's incomplete adjuvant, chromogenic reagent TMB : Sigma company product; Balb / c and C57BL / 6 mice; aminopterin, hypoxanthine and thymidine, and other reagents are commercially available.
[0046] 2. Methods and Results
[0047] 1. Preparation
[0048] 1) Aminopterin (A) stock solution (100×):
[0049] Dissolve 1.8mgA in 90ml of triple distilled water, add 0.5ml of 1mM NaOH dropwise with magnetic stirring to dissolve, add 0.5ml of 1mM HCL to neutralize, dilute to 100ml by filtration, sterilize in 1ml aliquots, and store at -20°C.
[0050] 2) Hypoxanthine and thymidine (HT) stock solution (100×):
[0051] H136mg, T39mg, add 100ml of triple distilled water, mix wel...
Embodiment 2
[0095] Example 2 Screening and Identification of Hybridoma Cell Strains Secreting Anti-Varistoxin Monoclonal Antibody
[0096] 1. Materials
[0097] 20% fetal bovine serum: product of Beijing Yuanheng Shengma Institute of Biotechnology; serum-free RPMI1640: product of Gibco; SP2 / 0 cells: imported from ATCC; chromogenic reagent TMB: product of Sigma; secondary antibody: goat anti-mouse- HRP; other reagents were commercially available.
[0098] 2. Methods and Results
[0099] 1. Screening of hybridoma cells:
[0100] (1) After fusion, when the hybrid cell colony grows to a certain size, the antibody activity can be screened (detected every time the medium is changed).
[0101] (2) ELISA detection, take 100 mL of the supernatant for measurement. After two times of detection, it is confirmed that there is a positive result, and the subcloning is carried out immediately (the cell growth accounts for about 1 / 4-1 / 3 of the bottom area of the well), and the subcloning is carried ...
Embodiment 3
[0129] Example 3 Fishing of the light and heavy chain genes of the anti-aspergillin monoclonal antibody ASH
[0130] 1. Materials
[0131] DNA fragment purification kit: product of OMEGA Biotechnology Company; T4DNA ligase: product of New England Biolabs; vector PGEM Teasy: product of Promega Company; competent bacteria JM109: purchased from Promega Company, the primers are as follows:
[0132] VLPD: GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA
[0133] VHPD: GTTCTGACTAGTGGGCACTCTGGGCTC
[0134] VHPU5: AGGTCCAACTGCTCGAGTCTGG
[0135] VHPU6: AGGTCCAACTGCTCGAGTCAGG
[0136] VHPU7: AGGTCCAACTTCTCGAGTCTGG
[0137] VHPU8: AGGTCCAACTTCTCGAGTCAGG
[0138] VLPU5: CCAGATGTGAGCTCGTGATGACCCAGACTCCA
[0139] VLPU6: CCAGATGTGAGCTCGTCATGACCCAGTCTCCA
[0140]VLPU7: CCAGTTCCGAGCTCGTGATGACACAGTCTCCA
[0141] All the other are with embodiment two.
[0142] 2. Method results
[0143] (1) get the cell 5 * 10 of the logarithmic growth phase that embodiment 2 screens out 6 ~1×10 7 centrifuge to r...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com