Bacillus subtilis LSSE-22 and application thereof

A technology of Bacillus subtilis and seeds, applied in the field of microorganisms, can solve the problems of low acceptance, unpleasant natto odor, late natto, etc.

Active Publication Date: 2013-08-14
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The development of natto in my country started relatively late, and the reported nattokinase-producing bacteria are mostly isolated from Japanese natto, which has an unpleasant natto smell. At present, the acceptance of natto food by our people is still relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis LSSE-22 and application thereof
  • Bacillus subtilis LSSE-22 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] The screening of embodiment 1 bacterial strain

[0074] The strain separation method of the present invention combines the plasminase activity separation method and the nattokinase gene PCR amplification method, and can quickly and accurately screen the nattokinase-producing strains. Add sterile water to the soybean paste product, heat at 80°C for 10 minutes, absorb the supernatant to dilute and spread on a screening medium plate (fibrin 12g / L, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L , agar powder 15g / L, pH 7.2), cultivated at 37°C for 48 hours, selected a single colony with a large transparent circle, and transferred it to an LB solid medium plate (peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L , agar powder 15g / L, pH 7.2), and stored in a refrigerator at 4°C after cultivation. After being activated by strains, it was transferred to sterilized chickpeas and fermented at 37°C for 48 hours. The strains with higher fibrinolytic activity were sel...

Embodiment 2

[0076] The identification of embodiment 2 bacterial strains

[0077] Morphology and Physiological and Biochemical Identification

[0078] Bacterial morphology and physiological and biochemical identification were carried out according to "Bergey's Bacterial Identification Manual". When the isolated strains were grown on LB solid medium, the edges of the colony were rough and the surface of the bacterial lawn was wrinkled. The suitable growth temperature is 28-40℃, and the suitable pH is 6.5-7.5. Casein hydrolysis positive, starch hydrolysis positive, nitrate utilization positive, citrate utilization positive, gelatin liquefaction test positive. The bacteria are straight rod-shaped, 1.8-2.9×0.8-1.2μm, and Gram staining is positive.

[0079] 16S rRNA molecular identification

[0080]The total DNA of the strain was extracted by a bacterial genome extraction kit, and the 16S rRNA gene PCR amplification was carried out with universal primers (27f: AGAGTTTGATCCTGGCTCAG) and (1492...

Embodiment 3

[0081] Embodiment 3 chickpea solid fermentation

[0082] 1. Use frozen Bacillus subtilis LSSE-22 as the original strain;

[0083] 2. Activation of slant strains:

[0084] Transfer the frozen-preserved strains to LB solid plates and culture them at 37°C for 12 hours.

[0085] 3. Seed liquid culture:

[0086] Transfer the activated seeds of the LB solid plate to the LB liquid medium, culture at 37°C, 180rpm for 8h;

[0087] 4. Preparation of chickpea substrate:

[0088] (1) Selection of chickpeas: remove discolored, mildewed, and moth-eaten chickpeas, remove sand, stones, soil clods and other sundries mixed in them, and wash both sides with water.

[0089] (2) Soaking: Add 5 times the volume (v / w) of water and soak at room temperature for 12 hours.

[0090] (3) Drain: drain the excess water in the soaked chickpeas, and the initial water content is 50%.

[0091] (4) Cooking: cooking under high temperature and high pressure at 115°C for 30 minutes, and cooling to room temper...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of microorganisms, and specifically relates to bacillus subtilis LSSE-22 and an application thereof. The invention provides the bacillus subtilis LSSE-22 with the preservation number of CGMCC No.4970. The invention also provides the application of the bacillus subtilis LSSE-22. The invention provides a natto food which is prepared by fermenting bean substrates through the bacillus subtilis LSSE-22. The bacillus subtilis LSSE-22 has higher natto kinase production activity, and when chick-peas are used as substrates, the highest activity of natto kinase reaches 356.25FU / g (the dry weight of the chick-peas). The natto kinase and an antioxidant active substance total phenol are prepared through simultaneous separation by using an ethanol separation method, the activity of the natto kinase reaches 2852.62FU / g (dry weight), the content of the total phenol reaches 14.78mg gallic acid / g (dry weight), and the method is simple and efficient.

Description

technical field [0001] The invention relates to the field of microorganisms, in particular, the invention relates to a bacillus subtilis LSSE-22 and an application thereof. Background technique [0002] Thrombosis is an important disease that endangers human health, and about 3 million patients die every year. Therefore, the development of thrombolytic drugs has always been a hot issue concerning human health. Traditional thrombolytic enzymes such as urokinase, plasminogen activator (t-PA) and streptokinase, etc., have short half-life, large side effects, high price, and low oral availability. The advantages of oral administration, safety, high efficiency, durability and low cost have become the hotspots in the development of thrombolytic products in recent years (Peng Y, Yang X, Zhang Y. Appl Microbiol Biotechnol, 2005, 69: 126-132). [0003] The current nattokinase products mainly include natto food and nattokinase health products. Natto food is made from beans fermente...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20A23L1/20C12R1/125C12N9/56A23L11/00
Inventor刘会洲魏雪团罗明芳谢渝春李昊剑杨良嵘
OwnerINST OF PROCESS ENG CHINESE ACAD OF SCI