Bacillus subtilis LSSE-22 and application thereof
A Bacillus subtilis and seed technology, applied in the field of microorganisms, can solve the problems of unpleasant natto odor, late natto, low acceptance and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] The screening of embodiment 1 bacterial strain
[0074] The strain separation method of the present invention combines the plasminase activity separation method and the nattokinase gene PCR amplification method, and can quickly and accurately screen the nattokinase-producing strains. Add sterile water to the soybean paste product, heat at 80°C for 10 minutes, absorb the supernatant to dilute and spread on a screening medium plate (fibrin 12g / L, peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L , agar powder 15g / L, pH 7.2), cultivated at 37°C for 48 hours, selected a single colony with a large transparent circle, and transferred it to an LB solid medium plate (peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L , agar powder 15g / L, pH 7.2), and stored in a refrigerator at 4°C after cultivation. After being activated by strains, it was transferred to sterilized chickpeas and fermented at 37°C for 48 hours. The strains with higher fibrinolytic activity were sel...
Embodiment 2
[0076] The identification of embodiment 2 bacterial strains
[0077] Morphology and Physiological and Biochemical Identification
[0078] Bacterial morphology and physiological and biochemical identification were carried out according to "Bergey's Bacterial Identification Manual". When the isolated strains were grown on LB solid medium, the edges of the colony were rough and the surface of the bacterial lawn was wrinkled. The suitable growth temperature is 28-40℃, and the suitable pH is 6.5-7.5. Casein hydrolysis positive, starch hydrolysis positive, nitrate utilization positive, citrate utilization positive, gelatin liquefaction test positive. The bacteria are straight rod-shaped, 1.8-2.9×0.8-1.2μm, and Gram staining is positive.
[0079] 16S rRNA molecular identification
[0080]The total DNA of the strain was extracted by a bacterial genome extraction kit, and the 16S rRNA gene PCR amplification was carried out with universal primers (27f: AGAGTTTGATCCTGGCTCAG) and (1492...
Embodiment 3
[0081] Embodiment 3 chickpea solid fermentation
[0082] 1. Use frozen Bacillus subtilis LSSE-22 as the original strain;
[0083] 2. Activation of slant strains:
[0084] Transfer the frozen-preserved strains to LB solid plates and culture them at 37°C for 12 hours.
[0085] 3. Seed liquid culture:
[0086] Transfer the activated seeds of the LB solid plate to the LB liquid medium, culture at 37°C, 180rpm for 8h;
[0087] 4. Preparation of chickpea substrate:
[0088] (1) Selection of chickpeas: remove discolored, mildewed, and moth-eaten chickpeas, remove sand, stones, soil clods and other sundries mixed in them, and wash both sides with water.
[0089] (2) Soaking: Add 5 times the volume (v / w) of water and soak at room temperature for 12 hours.
[0090] (3) Drain: drain the excess water in the soaked chickpeas, and the initial water content is 50%.
[0091] (4) Cooking: cooking under high temperature and high pressure at 115°C for 30 minutes, and cooling to room temper...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com