Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications
A technology encoding genes and genes, applied in the direction of plant gene improvement, application, plant peptides, etc., can solve problems such as heat resistance decline
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Cloning of embodiment 1, TaHSF1 gene
[0055] 1. Total RNA extraction and cDNA library construction
[0056] Sow white wheat on the seedbed, grow at 20-24°C for about 10 days, take it out from the soil, rinse it with distilled water, put it on filter paper and dry it for 2 hours, take the leaves and put them in liquid nitrogen immediately, and store them at -80°C for later use.
[0057] The total RNA of wheat leaves was extracted by Trizol method (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the first-strand cDNA was synthesized by reverse transcriptase XL (AMV) (TaKaRa). ds cDNA was synthesized by SMART method. PCR products were detected by 1.0% agarose gel electrophoresis.
[0058] 2. Acquisition of TaHSF1 protein and its coding gene
[0059] Taking the rice heat shock factor AK066316 as the known sequence, the wheat similar sequences were compared in the wheat database. After DNAMAN software analysis and design of primers 5'-ATGGGAAGCGAGTGCAAG-3' and ...
Embodiment 2
[0060] Embodiment 2, the activation characteristic of TaHSF1
[0061] 1. Construction of bait carrier
[0062] 1. Acquisition of TaHSF1 gene
[0063] Using the triticale cDNA obtained in step 1 as a template, TaHSF1-EI and TaHSF1-BI as primers (recognition sequences of EcoR I and BamH I were introduced at the ends of the primers respectively), PCR amplification was carried out, and the PCR amplification product was subjected to 1.2% agar Sugar gel electrophoresis detection. Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa, DV807A) was used to recover and purify a PCR product of about 750 bp. Sequencing results show that the PCR product contains the 711bp nucleotide sequence shown in Sequence 2 of the Sequence Listing.
[0064] TaHSF1-EI: 5'-GGAATTC ATGGGAAGCGAGTGCAAG -3';
[0065] TaHSF1-BI: 5'-CGGATCC TCAGTAGAACACCTGTCCCAGA -3'.
[0066] 2. Construction of recombinant expression vector
[0067] ① Recover the purified PCR product in step 1 by restriction enzymes EcoR...
Embodiment 3
[0073] Example 3, real-time fluorescent quantitative PCR analysis of the expression characteristics of the TaHSF1 gene
[0074] 1. Coercion treatment
[0075] The triticale seedling that the seedling age of hydroponic culture is 10 days carries out following treatment:
[0076] 1. Drought treatment: Take out the young white wheat seedlings to absorb the moisture on the roots, place them on dry filter paper, and cultivate them in a drought for 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, and 24 hours, then take out the materials. Quick-frozen in liquid nitrogen and stored at -80°C for later use.
[0077] 2. Salt treatment: place the young white wheat seedlings in 2% NaCl and Na 2 SO 4 In the sodium salt solution (NaCl and Na 2 SO 4 The mass percentage is 3:2), light cultured for 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, and 24 hours, respectively, the materials were taken out, quick-frozen in liquid nitrogen, and stored at -80°C for later use.
...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com