Check patentability & draft patents in minutes with Patsnap Eureka AI!

Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications

A technology encoding genes and genes, applied in the direction of plant gene improvement, application, plant peptides, etc., can solve problems such as heat resistance decline

Inactive Publication Date: 2013-09-25
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The plants obtained by silencing Arabidopsis HSF with HsfA iRNA by Mishra showed a significant decrease in heat tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications
  • Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications
  • Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Cloning of embodiment 1, TaHSF1 gene

[0055] 1. Total RNA extraction and cDNA library construction

[0056] Sow white wheat on the seedbed, grow at 20-24°C for about 10 days, take it out from the soil, rinse it with distilled water, put it on filter paper and dry it for 2 hours, take the leaves and put them in liquid nitrogen immediately, and store them at -80°C for later use.

[0057] The total RNA of wheat leaves was extracted by Trizol method (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the first-strand cDNA was synthesized by reverse transcriptase XL (AMV) (TaKaRa). ds cDNA was synthesized by SMART method. PCR products were detected by 1.0% agarose gel electrophoresis.

[0058] 2. Acquisition of TaHSF1 protein and its coding gene

[0059] Taking the rice heat shock factor AK066316 as the known sequence, the wheat similar sequences were compared in the wheat database. After DNAMAN software analysis and design of primers 5'-ATGGGAAGCGAGTGCAAG-3' and ...

Embodiment 2

[0060] Embodiment 2, the activation characteristic of TaHSF1

[0061] 1. Construction of bait carrier

[0062] 1. Acquisition of TaHSF1 gene

[0063] Using the triticale cDNA obtained in step 1 as a template, TaHSF1-EI and TaHSF1-BI as primers (recognition sequences of EcoR I and BamH I were introduced at the ends of the primers respectively), PCR amplification was carried out, and the PCR amplification product was subjected to 1.2% agar Sugar gel electrophoresis detection. Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa, DV807A) was used to recover and purify a PCR product of about 750 bp. Sequencing results show that the PCR product contains the 711bp nucleotide sequence shown in Sequence 2 of the Sequence Listing.

[0064] TaHSF1-EI: 5'-GGAATTC ATGGGAAGCGAGTGCAAG -3';

[0065] TaHSF1-BI: 5'-CGGATCC TCAGTAGAACACCTGTCCCAGA -3'.

[0066] 2. Construction of recombinant expression vector

[0067] ① Recover the purified PCR product in step 1 by restriction enzymes EcoR...

Embodiment 3

[0073] Example 3, real-time fluorescent quantitative PCR analysis of the expression characteristics of the TaHSF1 gene

[0074] 1. Coercion treatment

[0075] The triticale seedling that the seedling age of hydroponic culture is 10 days carries out following treatment:

[0076] 1. Drought treatment: Take out the young white wheat seedlings to absorb the moisture on the roots, place them on dry filter paper, and cultivate them in a drought for 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, and 24 hours, then take out the materials. Quick-frozen in liquid nitrogen and stored at -80°C for later use.

[0077] 2. Salt treatment: place the young white wheat seedlings in 2% NaCl and Na 2 SO 4 In the sodium salt solution (NaCl and Na 2 SO 4 The mass percentage is 3:2), light cultured for 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, and 24 hours, respectively, the materials were taken out, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications. The protein is characterized in that: (1) the protein is composed of an amino acid sequence shown as a sequence 1 in a sequence table; and (b) the protein is a at least one plant stress tolerance- associated protein, which is derived from the protein in (a), and of which the amino acid sequence of the sequence 1 in the sequence table is substituted and / or deleted and / or added by one or more amino acid residues, wherein the plant stress tolerance comprises drought tolerance and heat tolerance. Proved in an experiment, compared a T3 transgenic plant obtained by converting Arabidopis thaliana by a recombination expression vector pBI121-TaHSF1 of a DNA molecule shown in a sequence 2 of a sequence table, with a wild type and trans-empty carrier plant under same conditions, a survival rate in drought tolerance experiments can be raised from 21.3% to 75%; and a survival rate in heat tolerance experiments can be raised from 20% to 90%. The TaNHSF1 protein and coding genes thereof provided by the invention has important meanings for raising stress tolerance.

Description

technical field [0001] The invention relates to a stress-related protein and its coding gene and application in the field of biotechnology, in particular to a plant stress tolerance-related protein TaHSF1 and its coding gene and application. The protein TaHSF1 is derived from wheat and has the ability to improve plant Ability to resist drought and high temperature stress. Background technique [0002] Adversity stress such as high temperature is an obstacle factor affecting the growth and development of wheat. Therefore, understanding the response and signal transduction mechanism of wheat to stress conditions and improving the stress resistance of wheat varieties have become one of the important tasks of wheat genetic research and wheat variety improvement. [0003] Under adversity stress, plants will produce a series of responses, accompanied by many physiological, biochemical and developmental changes. Clarifying the response mechanism of plants to stress will provide s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N7/01C12N15/82A01H5/00
Inventor 徐兆师马有志张双喜李连城陈明
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More