Method for degrading plant lignin by using Bacillus subtilis engineering bacterial

A technology for degrading Bacillus subtilis and engineering bacteria, which is applied in the field of constructing and applying microbial engineering bacteria, can solve the problems of low enzyme yield, long period of degrading lignin, slow growth of white rot fungi, etc., and achieves rapid growth and reproduction and low nutritional requirements. Effect

Inactive Publication Date: 2013-09-25
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of using white rot fungi to degrade plant lignin is that white rot fungi have a complete enzyme system for degrading lignin (manganese peroxidase, lignin peroxidase and laccase). The manganese peroxidase gen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for degrading plant lignin by using Bacillus subtilis engineering bacterial
  • Method for degrading plant lignin by using Bacillus subtilis engineering bacterial
  • Method for degrading plant lignin by using Bacillus subtilis engineering bacterial

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0022] Example one

[0023] 1.1 Obtain the enzyme gene and the relevant original documents needed to construct the expression vector

[0024] (1) PCR amplification of the glyceraldehyde triphosphate dehydrogenase promoter sequence of Bacillus megaterium.

[0025] Extract the genomic DNA of Bacillus megaterium, use the genomic DNA as a template, and apply primer 5’TT TACGTA GATCCATTATCGGTGAACCA3’ and 5’GG GCATGC GGGAATACATTACGGCCGAT3') was subjected to PCR amplification, and the PCR product was sequenced and analyzed with the BLAST software provided by NCBI to prove that it was the promoter sequence of the glyceraldehyde triphosphate dehydrogenase gene.

[0026] (2) PCR amplification of the laccase gene of Bacillus subtilis

[0027] Use snailase to lyse the cell wall of Bacillus subtilis, extract Bacillus subtilis genomic DNA, and apply the upstream primer (5’AA CCTAGG ATGACACTTGAAAAATTTGTGGATGC3’) and downstream primers (5’AA GCGGCCGC CTATTTATGGGGATCAGTTATA3') was subjected to PCR a...

Example Embodiment

[0059] Example two

[0060] 2.1 Obtain the enzyme gene and the relevant original documents needed to construct the expression vector

[0061] (1) PCR amplification of the glyceraldehyde triphosphate dehydrogenase promoter sequence of Bacillus megaterium.

[0062] Extract the genomic DNA of Bacillus megaterium, use the genomic DNA as a template and apply primer 5’TT TACGTA GATCCATTATCGGTGAACCA3’ and 5’GG GCATGC GGGAATACATTACGGCCGAT3') was subjected to PCR amplification, and the PCR product was sequenced and analyzed with the BLAST software provided by NCBI to prove that it was the promoter sequence of the glyceraldehyde triphosphate dehydrogenase gene.

[0063] (2) PCR amplification of the laccase gene of Bacillus subtilis

[0064] Use snailase to lyse the cell wall of Bacillus subtilis, extract Bacillus subtilis genomic DNA, and apply upstream primer (5’AA CCTAGG ATGACACTTGAAAAATTTGTGGATGC3’) and downstream primer (5’AA GCGGCCGC CTATTTATGGGGATCAGTTATA3') was subjected to PCR amplifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for degrading plant lignin by using Bacillus subtilis engineering bacterial, and belongs to the technical field of biology. According to the method, manganese peroxidase gene, lignin peroxidase gene and laccase gene are respectively cloned from microorganisms, a Bacillus subtilis expression vector containing three gene expression cassettes is constructed, the Bacillus subtilis expression vector is transformed into Bacillus subtilis, G418 resistance screening is performed to obtain the Bacillus subtilis engineering bacterial containing the manganese peroxidase gene expression cassette, the lignin peroxidase gene expression cassette and the laccase gene expression cassette, and the Bacillus subtilis engineering bacterial acts with a plant raw material to degrade plant lignin. The method has the following advantage that: the Bacillus subtilis engineering bacterial provides a stronger lignin degradation effect compared with nature microorganisms for plant lignin degradation, wherein the nature microorganisms express and secrete manganese peroxidase, lignin peroxidase and laccase.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a method for constructing and applying microbial engineering bacteria. Specifically, it is a method for degrading lignin of plant raw materials by using microbial engineering bacteria. Background technique [0002] Manganese Peroxidase (MnP), Lignin Peroxidase (LiP) and Laccase have the function of degrading lignin together. [0003] Plant resources are constantly regenerated and are very rich. The basic components of plants are cellulose, hemicellulose and lignin. Among them, the most useful component in the manufacture of biogas and ethanol industry is cellulose, followed by hemicellulose. The former is composed of glucose while the latter is composed of pentose sugars. These sugars are converted into ethanol and biogas. However, the cellulose molecules are inlaid with lignin, and the inlaid cellulose cannot be hydrolyzed. Lignin is an amorphous, aromatic polymer containing oxyp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): D21C5/00C12N15/75C12N15/53C12N1/21C12R1/125
Inventor 张爱联符仙尹慧祥杨穗珊张添元罗进贤易国辉
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap