Novel protease and mutant as well as application thereof
A protease and mutant technology, applied in the field of genetic engineering and daily chemical industry, can solve problems such as gene mutation and achieve the effect of improving stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 Establishment of metagenomic library and acquisition of positive clones, gene cloning and expression
[0058] 1. Extraction of total DNA:
[0059] Weigh 5g of seabed mud sample (taken from the seabed at a depth of 1340m in the Southwest China Sea), add 13.5mL DNA extraction buffer (0.1M Tris, 0.1M EDTA-Na, 0.1M Na 3 PO 4 , 1.5M NaCl, 1% CTAB, pH 8.0), vigorously shake and mix, add 300μL lysozyme (100mg / ml), invert repeatedly 5-6 times, 37℃ water bath for 30min, add 1.5ml 20% SDS, 65℃ water bath Centrifuge at 8000rpm for 5min for 1h (upside down several times every 15min), take the supernatant, extract twice with an equal volume of chloroform, centrifuge at 8000rpm for 10min, take the supernatant, add 0.6 times the volume of isopropanol, and place at room temperature for 2h , centrifuge at 20,000rpm for 20min, discard the supernatant, add 5mL of pre-cooled 70% ethanol to the pellet, centrifuge at 20,000rpm for 10min, collect the DNA precipitate, air-dry, and ...
Embodiment 2
[0074] Example 2 Gene mutation of S102 and construction of vector multimer containing insertion mutant gene
[0075] 1. Gene mutation of S102:
[0076] Design a pair of primers based on the sequencing results:
[0077] S102-PstI:ATTAT CTGCAG GCGCAATCAGTGCCATG (underlined and italic parts are restriction enzyme sites)
[0078] S102-BamHI:AACTGCTCATACTA GGATCC GCGTGTTGCCGCTTCTGCAT (underlined and italic parts are restriction enzyme sites);
[0079] Using two primers, the plasmid pBE3-s102 was used as a template for error-prone PCR (ep-PCR) amplification reaction. The PCR system was as follows:
[0080]
[0081] The PCR conditions were: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 1 min, annealing at 66°C for 1 min, extension at 72°C for 50 s, 26 cycles, incubation at 72°C for 10 min, and cooling to 4°C. After PCR, 1 μL of the solution was taken from each tube for agarose gel electrophoresis, and a marker of corresponding molecular weight was used as a c...
Embodiment 3
[0093] Example 3 Enzyme Activity Determination Method and Construction of IVC Screening System
[0094] 1. Determination of enzyme activity (Suc-AAPF-PNA method)
[0095] ①Centrifuge 2ml of the bacterial solution at 6,000rpm for 2min, then resuspend the bacterial cells with 200μl of Tris-Hcl (pH=8) buffer, and take 30μl of the resuspended solution for protease activity on the cell wall. In order to prevent the newly synthesized protease from interfering with the experimental results, chloramphenicol (transcription inhibitor) was added at a final concentration of 20 μg / ml.
[0096] ②Mix 30 μl of resuspended concentrated bacteria liquid with 300 μl of Tris-Hcl (pH=8) buffer, add 10 μl of 10 mM Suc-AAPF-PNA DMSO solution to the mixture, bathe in water at 37°C for 14 minutes, and use 305 μl of Tris at the same time -Hcl (pH=8, containing chloramphenicol with a final concentration of 20 μg / ml) and 10 μl of 2% 10 mM Suc-AAPF-PNA DMSO mixed solution were used as a control.
[0097]...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More