A kind of method for synthesizing l-theanine by enzymatic method

An enzymatic synthesis, theanine technology, applied in the field of bioengineering, to achieve the effect of simple reaction method, good thermal stability, good activity and stability

Active Publication Date: 2017-03-08
JIANGNAN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there have been no examples of using γ-glutamyl transpeptidase from microbial sources or genetic engineering sources as a catalyst to produce theanine at a high substrate concentration suitable for industrial production scale to obtain a high substrate conversion rate literature report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method for synthesizing l-theanine by enzymatic method
  • A kind of method for synthesizing l-theanine by enzymatic method
  • A kind of method for synthesizing l-theanine by enzymatic method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of ggt-pET20b(+) / E.coli BL21(DE3)

[0024] (1) According to the γ-glutamyl transpeptidase gene sequence of Bacillus subtilis 168 (NCBI Gene ID: 940001) on NCBI, the γ-glutamyl transpeptidase gene was obtained by chemical synthesis, and the gene was used as a template to design Primers P1, P2, P1: 5'–AT CCATGG ATAAAAAAACCGCCCAAAAGCTACGA–3’ (underlined is the enzyme cutting site NocI), P2: 5’–GGCG CTCGAG TTATTTACGTTTTAAATTAATGC-3' (the underline is the restriction site XhoI), the gene was amplified by PCR. The PCR system was 50 μl, and the PCR program was: pre-denaturation at 94°C for 4 minutes, followed by 30 cycles of "incubating at 98°C for 10 s, 55°C for 5 s, and 72°C for 120 s", and finally at 72°C for 10 min. The amplified target fragment was recovered and purified by gel and ligated with pMD18-T simple vector. After the ligation product is chemically transformed into Escherichia coli JM109, the transformation mixture is spread on an amp...

Embodiment 2

[0027] Embodiment 2: fermentation produces enzyme

[0028] (1) Fermentation culture

[0029] The genetically engineered bacteria ggt-pET20(b) / E.coli BL21(DE3) obtained in Example 1 was inoculated in LB / Amp liquid medium and then cultured at 37°C for 8-10 hours and then transferred to TB / Amp liquid medium containing 0.75% glycine, cultured at 37°C for 3 hours, then induced with 0.4mM / L IPTG (isopropylthio-β-D-galactoside), cooled to 25°C and incubated at a constant temperature for 40-48h to induce Enzymes. After the fermentation, the supernatant collected by centrifugation is the crude enzyme liquid.

[0030] (2) Enzyme activity assay

[0031] The color reaction was carried out with γ-glutamyl-p-nitroaniline (γ-GpNA) and glyceryl dipeptide (Gly-Gly) as substrates. The enzyme activity assay system is 1mL (contains a final concentration of 5mmol / L γ-glutamyl p-nitroanilide (γ-GpNA), 80mmol / L glyceryl dipeptide (Gly-Gly), 50mM borax-NaOH buffer, pH10) After adding 20 μL of appr...

Embodiment 3

[0033] Embodiment 3: the concentration of crude enzyme liquid

[0034] Slowly add thionine with a concentration of 60% relative to the mass fraction of the enzyme solution to the enzyme solution obtained in Example 2 while stirring, stir until the thionine is dissolved, and stand at 4°C for 8-10 hours to precipitate protein. The mixture was centrifuged (8000rpm, 10min) to collect the precipitate, and then reconstituted with a minimum volume of 50mM Tris-HCl buffer (pH8). According to the difference in reconstituted volume, the enzyme activity of the concentrated enzyme solution is 300-400U / ml.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing L-theanine through an enzyme process, and belongs to the biotechnical field. The method is characterized in that a gamma-glutamyltranspeptidase gene is obtained through chemical synthesis, a gene engineering bacterium over-expressing gamma-glutamyltranspeptidase is constructed by treating Escherichia coli as a host bacterium, glutamine and ethylamine hydrochloride having different concentrations are acted by a recombinase, and theanine is efficiently produced at a temperature of 37-50DEG C under a pH value of 9.5-10.5. The enzyme source preparation process has the advantages of simplicity, low cost, and large enzyme amount, and the theanine production method has the advantages of simplicity, high conversion rate, high output, short time and the like, and is in favor of the industrialized amplification production.

Description

technical field [0001] The invention relates to a synthesis method of L-theanine, in particular to a method for preparing L-theanine by using microbial enzymes with L-glutamine and ethylamine hydrochloride as substrates, belonging to the technical field of bioengineering . Background technique [0002] Theanine, also known as (C 7 h 14 o 3 N 2 , also known as γ-glutamyl ethylamine), is a non-essential amino acid present in green tea and an important flavor substance of tea. Drinking tea has always been hailed as a healthy food that is good for the body and mind, relaxing and wise. In recent years, more and more scientific research has proved that theanine is one of the active substances in green tea, and it can reduce mental stress in terms of physiology and pharmacology. , Improve cognitive behavior and learning ability, inhibit obesity, lower blood pressure, enhance immunity and prevent tumor occurrence. Therefore, theanine has a wide demand in beverages, functional ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P13/04
Inventor吴敬陈星奕宿玲恰陈坚
OwnerJIANGNAN UNIV