Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiplex ligation-dependent probe real-time fluorescence PCR (Polymerase Chain Reaction) kit for detecting drug resistance of HBV (Hepatitis B Virus) lamivudine and/or adefovir

A technology of multiple connection probes and real-time fluorescence, which is applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve the effect of optimized reaction conditions and low cost

Inactive Publication Date: 2013-11-27
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional MLPA technology is used, that is, the use of capillary electrophoresis to quantitatively analyze the DNA target sequence to be tested or the use of chip hybridization technology to quantify and type the pathogenic nucleic acid, which requires the synthesis of a large number of probes of different lengths, or the need for probes Complex operation steps such as fixation, hybridization and elution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex ligation-dependent probe real-time fluorescence PCR (Polymerase Chain Reaction) kit for detecting drug resistance of HBV (Hepatitis B Virus) lamivudine and/or adefovir
  • Multiplex ligation-dependent probe real-time fluorescence PCR (Polymerase Chain Reaction) kit for detecting drug resistance of HBV (Hepatitis B Virus) lamivudine and/or adefovir
  • Multiplex ligation-dependent probe real-time fluorescence PCR (Polymerase Chain Reaction) kit for detecting drug resistance of HBV (Hepatitis B Virus) lamivudine and/or adefovir

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Design of Universal Primers, TaqMan Probes and MLPA Probes

[0042]A pair of universal primers were designed in the alfalfa chloroplast genome by using primer premier 6.0 software, and five TaqMan probe sequences were designed by using Primer Express 3.0 software as the tag sequences of MLPA probes, respectively labeled FAM, HEX, ROX, CY5 and LC red705 fluorescein (Shanghai Sangong). The Tm value of the probe is about 10°C higher than the Tm value of the primer, and the probe self-dimer, hairpin structure and cross-dimer structure are minimum. Firstly, the nucleic acid sequence of HBV P gene was retrieved from the NCBI nucleic acid database, and multiple sequence alignments were performed using clustalx1.83 software. According to the main epidemic types B and C of HBV in China, MLPA was designed to detect rtM204V, rtM204I, rtA181T, rtA181V and rtN236T sites As for the probe, the Tm value of the hybridization sequence of the MLPA probe is greater than 65°C, an...

Embodiment 2

[0046] Embodiment 2 Preparation and application of the kit

[0047] 1. Materials and methods

[0048] patient sample

[0049] Sera from 116 outpatients and inpatients from the Department of Infectious Diseases, Southwest Hospital of Third Military Medical University from March 2012 to June 2013 were collected, all of which were positive for HBV DNA load. This experimental protocol was approved by the Ethics Committee of the Third Military Medical University.

[0050] DNA extraction and PCR amplification before detection

[0051] The HBV genome was extracted using the care HBV RT-PCR Assay v2kit (Capgemini, Germany), and the reverse transcription region of the P gene was amplified using the Prime STAR Max DNA Polymerase Kit (Bao Bio, Japan):

[0052] ccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnology field and particularly relates to a multiplex ligation-dependent probe real-time fluorescence PCR (Polymerase Chain Reaction) technology for detecting the drug resistance of chronic hepatitis B. A multiplex ligation-dependent probe real-time fluorescence PCR kit comprises an MLPA (Multiplex Ligation-dependent Probe Amplification) probe set, a filling sequence and a universal primer, wherein probes are respectively designed according to mutation sites rtM204V, rtM204I, rtA181T, rtA181V and rtN236T of a P gene reverse transcription region of HBV (Hepatitis B Virus); the sequences of the probes are represented by SEQ ID NO: 1-10. The invention further relates to a method for detecting the drug resistance of the HBV lamivudine and adefovir by virtue of the kit. The method combines the high throughput of an MPLA technology, and the rapidness, sensitivity and real-time detection of real-time fluorescence PCR, and has a high coincidence rate compared with a direct sequencing method, and can be used for detecting samples which cannot be detected by the sequencing method due to insufficient sensitivity; a whole detection process takes 4-5 hours; the clinic hepatitis B drug resistance detection method provided by the invention is low in cost and quick in detection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a real-time fluorescent PCR technology of multiple connection probes for detecting drug resistance of chronic hepatitis B. Background technique [0002] Chronic hepatitis B remains a major public health problem worldwide. In China, two drugs, lamivudine and adefovir, have become the first-line drugs for the treatment of chronic hepatitis B. However, the generation of HBV drug resistance has become the main obstacle to the success of long-term treatment of chronic hepatitis B. Therefore, it is very important to detect whether the HBV infected by patients is resistant to lamivudine and adefovir for the selection of clinical anti-HBV drugs. At present, a variety of methods for the detection of hepatitis B drug resistance have been reported, including direct sequencing of PCR products, reverse linear hybridization (INNO LIPA), gene chip and real-time PCR and other technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 贾双荣陈鸣邓少丽李发科唱凯蒋文斌商亚杨绍俊
Owner THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products