Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1
A wheat salt-tolerant gene and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of improving salt tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1, the cloning of TaAOC1
[0029] 1.1 Processing of plant material
[0030] 1) Vernalization of wheat seeds (Shanrong No. 3) at 4°C for 20 days
[0031] 2) Treat the seeds with 70% alcohol for 2-3 minutes.
[0032] 3) Discard the alcohol, wash with sterile water for 3-5 times, shake and mix well each time.
[0033] 4) Soak the seeds in sterile water, avoid light, incubate overnight at 25°C, 40-60rpm / min, on a shaking table.
[0034] 5) Place the seeds face up on filter paper fully moistened with sterile water, and germinate in the dark.
[0035] 6) After 3 days, the seeds were transferred to the culture basket, 1 / 2 Hoagland, hydroponics, placed at 23°C, and grown to the stage of two leaves and one heart in the long-day culture room.
[0036] 1.2 Wheat RNA extraction
[0037] 1) Weigh the cryogenically frozen 30-50 mg RNA extraction sample and quickly transfer it to a mortar pre-cooled with liquid nitrogen, grind the tissue with a pestle, and add liquid n...
Embodiment 2
[0068] Embodiment 2, wheat transformation and transgenic plant screening
[0069] 2.1 Germination of wheat seeds
[0070] 1) Sterilize plump and intact wheat seeds, soak them in 70% ethanol for 30 sec, and then soak them in 0.1% HgCl2 for 15 min. Shake the seeds constantly during soaking to ensure thorough surface sterilization, and then rinse with sterile water 4-5 times.
[0071] 2) Put the sterilized seeds in a sterile petri dish, add an appropriate amount of sterile water to germinate under dark conditions at 15-35°C.
[0072] 2.2 Transformation of wheat
[0073] 1) One day before transformation, take 2ml of activated Agrobacterium and add it to 200ml of YEP medium containing corresponding antibiotics, and culture overnight until OD600=1.0-1.2.
[0074] 2) Collect the bacteria by centrifugation, and resuspend in the liquid infusion solution (containing 0.2% AS) to make OD600=0.8.
[0075] 3) Peel off the coleoptile and young leaves of the spare etiolated seedlings with...
Embodiment 3
[0084] Example 3, Analysis of Stress Expression of TaAOC1
[0085] 3.1 Extraction of RNA under stress
[0086] The seeds of Shanrong 3 and Jinan 177 germinated normally, and Hoagland culture medium was cultured to the two-leaf one-heart stage (about 3 weeks) and began to be subjected to drought (18% PEG), salt stress (200mM NaCl), H 2 o 2 (10mM) treatment. After treatment for different time, the seedling root and leaf RNA was extracted by Trizol method as above.
[0087] 3.2 Reverse transcription to obtain cDNA
[0088] Reverse transcription generated cDNA as above.
[0089] 3.3 PCR reaction and electrophoresis
[0090] 1) Using cDNA as a template, carry out PCR reaction. Primers are as follows:
[0091] QRT-1: CGTCTTCGAGGGCGTCTACG
[0092] QRT-2: GCAGGTCGGGGATGCCCTTGA
[0093] 2) PCR system:
[0094]
[0095] 3) PCR program:
[0096] 95℃5min; 40cycles95℃30s, 60℃30s, 72℃30s; 72℃5min.
[0097] 4) QRT data analysis. see results Figure 4 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



