Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1

A wheat salt-tolerant gene and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of improving salt tolerance

Inactive Publication Date: 2013-12-04
SHANDONG UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cDNA nucleotide sequence of the allene oxide cyclase (AOC) gene TaAOC1 and the application of the gene in cultivating salt-tolerant plants have not been reported before the application of the present invention.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1
  • Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1
  • Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, the cloning of TaAOC1

[0029] 1.1 Processing of plant material

[0030] 1) Vernalization of wheat seeds (Shanrong No. 3) at 4°C for 20 days

[0031] 2) Treat the seeds with 70% alcohol for 2-3 minutes.

[0032] 3) Discard the alcohol, wash with sterile water for 3-5 times, shake and mix well each time.

[0033] 4) Soak the seeds in sterile water, avoid light, incubate overnight at 25°C, 40-60rpm / min, on a shaking table.

[0034] 5) Place the seeds face up on filter paper fully moistened with sterile water, and germinate in the dark.

[0035] 6) After 3 days, the seeds were transferred to the culture basket, 1 / 2 Hoagland, hydroponics, placed at 23°C, and grown to the stage of two leaves and one heart in the long-day culture room.

[0036] 1.2 Wheat RNA extraction

[0037] 1) Weigh the cryogenically frozen 30-50 mg RNA extraction sample and quickly transfer it to a mortar pre-cooled with liquid nitrogen, grind the tissue with a pestle, and add liquid n...

Embodiment 2

[0068] Embodiment 2, wheat transformation and transgenic plant screening

[0069] 2.1 Germination of wheat seeds

[0070] 1) Sterilize plump and intact wheat seeds, soak them in 70% ethanol for 30 sec, and then soak them in 0.1% HgCl2 for 15 min. Shake the seeds constantly during soaking to ensure thorough surface sterilization, and then rinse with sterile water 4-5 times.

[0071] 2) Put the sterilized seeds in a sterile petri dish, add an appropriate amount of sterile water to germinate under dark conditions at 15-35°C.

[0072] 2.2 Transformation of wheat

[0073] 1) One day before transformation, take 2ml of activated Agrobacterium and add it to 200ml of YEP medium containing corresponding antibiotics, and culture overnight until OD600=1.0-1.2.

[0074] 2) Collect the bacteria by centrifugation, and resuspend in the liquid infusion solution (containing 0.2% AS) to make OD600=0.8.

[0075] 3) Peel off the coleoptile and young leaves of the spare etiolated seedlings with...

Embodiment 3

[0084] Example 3, Analysis of Stress Expression of TaAOC1

[0085] 3.1 Extraction of RNA under stress

[0086] The seeds of Shanrong 3 and Jinan 177 germinated normally, and Hoagland culture medium was cultured to the two-leaf one-heart stage (about 3 weeks) and began to be subjected to drought (18% PEG), salt stress (200mM NaCl), H 2 o 2 (10mM) treatment. After treatment for different time, the seedling root and leaf RNA was extracted by Trizol method as above.

[0087] 3.2 Reverse transcription to obtain cDNA

[0088] Reverse transcription generated cDNA as above.

[0089] 3.3 PCR reaction and electrophoresis

[0090] 1) Using cDNA as a template, carry out PCR reaction. Primers are as follows:

[0091] QRT-1: CGTCTTCGAGGGCGTCTACG

[0092] QRT-2: GCAGGTCGGGGATGCCCTTGA

[0093] 2) PCR system:

[0094]

[0095] 3) PCR program:

[0096] 95℃5min; 40cycles95℃30s, 60℃30s, 72℃30s; 72℃5min.

[0097] 4) QRT data analysis. see results Figure 4 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a salt-tolerant gene for wheat, a plant expression vector and particular application of the gene TaAOC1. The salt-tolerant gene is allene oxide reduction enzyme gene TaAOC1 and is applied to cultivating salt-tolerant plants, in particular to cultivating wheat, and the plant expression vector comprises the gene TaAOC1. The salt-tolerant gene TaAOC1, the plant expression vector and the application have the advantages that as proved by experiments, the salt tolerance of transgenic plants which are subjected to transgenosis by the aid of the salt-tolerant gene is obviously improved, and a foundation is laid for widely applying the gene to cultivating new species of salt-tolerant crop.

Description

technical field [0001] The invention relates to a wheat salt-tolerant gene and its application, in particular to the salt-tolerant gene allene oxide reductase gene TaAOC1 and its application, and belongs to the technical field of biogenetic engineering. Background technique [0002] Soil salinization seriously affects crop yields. Especially with the development of industry, soil salinization is becoming more and more serious, which has become a social problem of global concern. my country has a large population, and soil salinization is more serious, which has become an important factor restricting my country's economic and social development. Therefore, in addition to alleviating soil salinization, cultivating new varieties of salt-tolerant crops has become a very urgent task at present. [0003] It is a technology with broad application prospects to use transgenic improved plant technology to transfer new traits into high-biomass plants to develop new high-efficiency tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/61C12N15/63C12N15/82A01H5/00
Inventor夏光敏赵阳董蔚
OwnerSHANDONG UNIV