Unlock instant, AI-driven research and patent intelligence for your innovation.

Cloning of mulberry resveratrol synthase gene and construction of plant expression vector

A technology for resveratrol and synthase, which is applied in plant products, botanical equipment and methods, angiosperms/flowering plants, etc., and can solve problems such as unseen and cloned resveratrol synthase genes

Inactive Publication Date: 2014-07-02
TIANJIN UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the resveratrol synthase gene has been cloned from grapes, peanuts, knotweed and other plants, but there is no report on cloning the resveratrol synthase gene from mulberry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning of mulberry resveratrol synthase gene and construction of plant expression vector
  • Cloning of mulberry resveratrol synthase gene and construction of plant expression vector
  • Cloning of mulberry resveratrol synthase gene and construction of plant expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Mulberry total RNA extraction

[0048] Add 700 μL CTAB lysate [0.1mol / L Tris-Cl (pH8.0), 1.4mol / L NaCl, 0.05mol / L EDTA, 2g / 100mL CTAB, 2g / 100mL PVP] to 100mg of mulberries after liquid nitrogen grinding, vortex After vortexing and mixing, place in a 60°C water bath for 30 minutes; add an equal volume of chloroform, shake and mix, and centrifuge at 12,000 rpm for 10 minutes at room temperature, and take the supernatant; add 1 / 4 volume of 10mol / L LiCl, place for 30 minutes, and centrifuge at 12,000 rpm for 10 minutes. Discard the supernatant; add 1 mL of 75% ethanol to rinse the precipitate, centrifuge at 12,000 rpm for 5 min, discard the supernatant; add appropriate amount of DEPC-treated water to dissolve RNA after natural drying.

Embodiment 2

[0050] Mulberry resveratrol synthase gene ( MRS ) central conserved region clone

[0051] Take 1 μg of total RNA, use Random hexamer as a primer, and follow the instructions of RevertAidTM H Minus First Strand cDNA Synthesis kit to reverse transcribe to generate first-strand cDNA.

[0052] A pair of primers were designed according to the conservation of the stilbene synthase gene sequences of plants such as grapes, peanuts, and Polygonum cuspidatum, as shown in the sequence table: SEQ ID NO.1: SP1 5' AGGCAATCAAAGAGTGGGG 3' and SEQ ID NO.2: SP2 5' TGAGCAATCCAAAATATTGAGTT 3'.

[0053] The PCR reaction was carried out in a 25mL system containing 1×Dream Buffer (with 2mmol / L MgCl 2 ), 200μmol / L dNTP, 0.5mmol / L primer, 2U Dream Taq DNA polymerase, 1 mL first-strand cDNA. The PCR cycle was pre-denaturation at 95°C for 5 min; followed by 30 cycles, each cycle of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s; finally, full extension at...

Embodiment 3

[0061] Mulberry resveratrol synthase gene ( MRS ) 3′ RACE

[0062] The nested primers for 3'RACE were designed according to the sequence of the central conserved region, as shown in the list: SEQ ID NO.3: SP3 5' CGCTGATGGTGGGTCGGCTGTA3' and SEQ ID NO.4: SP4 5' GATGAGGGCTCCGCCGAAAGAC 3'.

[0063] The reverse transcription reaction system and reaction conditions were operated according to the instructions of 3′-Full RACE Core Set Ver.2.0. The first round of PCR was carried out with SP1 and the 3'RACE Outer Primer of the kit, and the second round of PCR was carried out with SP2 and the 3'RACE Inner Primer of the kit. After TA cloning of the amplified products, at least 3 to 5 clones were selected for sequencing.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to cloning of a mulberry resveratrol synthase gene and construction of a plant expression vector. The gene has a nucleotide sequence shown by SEQ ID NO.7. Total RNA is extracted from fresh mulberry fruits, and the mulberry resveratrol synthase gene (MaRS) is cloned by using 3'RACE technology to obtain a complete gene sequence of 1496bp. A plant expression vector pCAMBIA2300-MaRS-Kana is constructed. The plant expression vector pCAMBIA2300-MaRS-Kana is transferred into agrobacterium C58 cells by electroporation, the activity of the enzyme coded by the cloned MaRS gene is verified by using a tobacco plant expression system, the MaRS gene can catalyze the combination of trans coumaric acid COA and malonyl-COA in tobacco to form resveratrol, and move the metabolic direction to downstream to synthesize a resveratrol derivative, and the gene is proved to be capable of improving the resveratrol content of a plant, therefore the MaRS gene has a development value of being applied to health food and beauty products. In addition, the MaRS gene can improve the disease resistance of the plant, thereby having a value of being applied to plant stress-tolerance gene engineering.

Description

technical field [0001] The invention relates to the cloning of a resveratrol synthase (RS) gene and the construction of a plant expression vector, specifically the mulberry resveratrol synthase gene ( MRS ) clones. Background technique [0002] Resveratrol synthase is a key enzyme in the biosynthetic pathway of resveratrol (Res) in plants. Resveratrol synthase can catalyze the combination of trans-coumaric acid-COA and malonyl-COA in the phenylalanine metabolic pathway to form resveratrol. [0003] The chemical name of resveratrol is 3,4,5-trihydroxystilbene, which is a polyhydroxystilbene compound, which is mostly present in the xylem of plants. At present, Res has been found in 21 families, 31 genera, and 72 species of plants, such as Vitis genus and Snake Grape genus in the Vitaceae family, Arachis and Cassia in the Fabaceae family, and Polygonum genus in the Polygonaceae family. The plants where this substance exists are mostly common medicinal plants, such as cassia,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N9/00C12N15/82C12N1/21C12N5/10A01H5/00
Inventor 王罡王萍季静易乐飞钟影周向红
Owner TIANJIN UNIV