Bacillus subtilis gene engineering bacterial producing Neu5Ac, construction method and application thereof
A technology of Bacillus subtilis and acetylneuraminic acid, which is applied in the field of bioengineering, can solve the problems of complex genetic modification and unclear metabolic background, and achieves the effect of simple production process and environmental friendliness.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Construction of neuBC and glmS gene tandem expression vector
[0024] 1. Construction of neuBC gene expression vector pHT01-neuBC
[0025] 1) The neuBC gene was synthesized according to the neuBC gene sequence (GenBank No.AF400048), with BamHI and XbaI sites added at both ends. The specific sequence is shown below (SEQ ID NO.1).
[0026] GGATCCATGAAAGAAATAAAAATACAAAATATAATCATAAGTGAAGAAAAAGCACCCTTAGTCGTACCTGAAATAGGCATTAATCATAATGGCAGTTTAGAACTAGCTAAAATTATGGTAGATGCAGCCTTTAGCGCAGGTGCTAAGATTATAAAGCATCAAACTCATATTGTTGAAGATGAGATGAGTAAGGCCGCTAAAAAAGTAATTCCTGGTAATGCAAAAATAAGCATTTATGAGATTATGCAAAAATGTGCTTTGGATTATAAAGATGAGCTAGCACTTAAAGAATACACAGAAAAATTAGGTCTTGTTTATCTTAGCACACCTTTTTCTCGTGCAGGTGCGAACCGCTTAGAAGATATGGGAGTTAGTGCTTTTAAGATTGGTTCAGGTGAGTGTAATAATTATCCGCTTATTAAACACATAGCAGCCTTTAAAAAGCCTATGATAGTTAGCACAGGAATGAATAGTATTGAAAGTATAAAACCAACTGTAAAAATCTTATTAGACAATGAAATTCCTTTTGTTTTAATGCACACGACCAATCTTTACCCAACCCCGCATAATCTTGTAAGATTAAACGCTATGCTTGAGTTAAAAAAAGAATTTTCTTGTATGGTAGGCTTAAG...
Embodiment 2
[0036] Embodiment 2: Construction of N-acetylneuraminic acid Bacillus subtilis genetically engineered bacteria
[0037] 1) Cultivate the E. coli DH5α strain containing the vector pHT01-neuBC-glmS overnight in liquid LB medium, and extract the plasmid pHT01-neuBC-glmS.
[0038] 2) Cultivate Bacillus subtilis 164 and 168 strains respectively to prepare competent cells, and transform the plasmid vector pHT01-neuBC-glmS into it by electroporation to obtain genetically engineered strains 164 / pHT01-neuBC-glmS and 168 / pHT01-neuBC-glmS, namely N-acetylneuraminic acid-producing genetically engineered bacteria are available, named CASOV-3 and CASOV-4, which have been deposited in the Chinese Type Culture Collection on December 31, 2013 and February 18, 2014, respectively. Center, the deposit numbers are CCTCC NO:M2013731 and CCTCC NO:M2014038 respectively.
Embodiment 3
[0039] Example 3 Glucose is used as carbon source to ferment and produce N-acetylneuraminic acid
[0040] 1. Seeds and fermentation medium:
[0041] (NH4) 2 SO 4 4g / L; KH 2 PO 4 6g / L; K 2 HPO 4 ·3H 2 O8g / L; yeast extract (purchased from OXOID company) 5g / L; peptone 10g / L; glucose 5g / L.
[0042] Feed solution: 500g / L glucose.
[0043] 2. Fermentation process:
[0044] 1) Pick a single colony of CASOV-3 or CASOV-4 into a 4ml LB test tube, and incubate at 37°C for 8-12 hours.
[0045] 2) Inoculate 2ml of first-grade seeds into 200ml of seed medium and incubate at 37°C for 8-10 hours.
[0046] 3) The secondary seeds are inoculated in a fermenter with a liquid volume of 3.5L, at 37°C, with a stirring speed of 300-800 rpm, and the dissolved oxygen is kept above 30%, and the pH is controlled at 6.9 with ammonia water.
[0047] 4) After the glucose is used up, add glucose at a rate of 5g / L.h.
[0048] 5) OD of fermentation broth 600 Add IPTG (final concentration of IPTG i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap