Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains

A technology of aminolevulinic acid and Escherichia coli, applied in the fields of metabolic engineering and microbial fermentation, can solve the problem of high cost of ALA, and achieve the effect of shortening the fermentation period and reducing the production cost

Active Publication Date: 2014-08-27
JIANGNAN UNIV
View PDF5 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current biotransformation based on the C4 pathway is relatively expensive due to the addition of the precursors succinate and glycine to produce ALA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains
  • Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains
  • Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Construction and identification of embodiment 1 recombinant plasmid

[0048] (1) Construction of recombinant plasmids pACYCDuet-1-hemLA, pCDFDuet-1-hemD, pCDFDuet-1-hemF, and pCDFDuet-1-hemD-hemF

[0049] HemL, hemD, and hemF were obtained using the E. coli genome as a template, and hemA was derived from Salmonella typhi

[0050] The primers are as follows (the underlined part is the restriction site)

[0051] hemL-hemAF:CGC GGATCC ATAAAAGGAGGAAAATATATGAGTAAGTCTGAA

[0052] hemL-hemAR:TGCA CTGCAG CTACTCCAGCCGAGGCTG

[0053] hemD-F:CGC CATATG AGTATCCTTGTCACCCGCC

[0054] hemD-R:CCG CTCGAG TTATTGTAATGCCCGTAAAAGCG

[0055] hemF-F:CGC CATATG AAACCCGACGCACACC

[0056] hemF-R:CCG CTCGAG TTACACCCAATCCCTGACCTTAAT

[0057] hemD(2)-F:CGC GGATCC ATAAAAGGAGGAAAATATATGAGTATCCTTGTCACCCG

[0058] hemD(2)-R:TGCA CTGCAG TTATTGTAATGCCCGTAAAAGCG

[0059] The reaction conditions are: 94°C for 5min; 94°C for 30s, 58°C for 30s, 72°C for 150s (hemL-hemA) / 60s (hemD and ...

Embodiment 2

[0063] Embodiment 2 Recombinant bacteria shaking flask fermentation verification

[0064] Strains:

[0065] LA: E.coli BL21(DE3)pACYCDuet-hemLA pCDFDuet-1

[0066] LAD:E.coli BL21(DE3)pACYCDuet-hemLA pCDFDuet-hemD

[0067] LAF:E.coli BL21(DE3)pACYCDuet-hemLA pCDFDuet-hemF

[0068] LADF:E.coli BL21(DE3)pACYCDuet-hemLA pCDFDuet-hemD-hemF

[0069] Different recombinant Escherichia coli and control bacteria were compared in fermentation experiments. Recombinant bacteria LAD, LAF and LADF were fermented to determine the ALA production as image 3 Shown: by expressing hemD and hemF alone and together, compared with the control strain LA, the ALA production is improved, and the ALA production is the highest under the situation of expressing the two enzyme genes at the same time, which is 1200mg / L ( image 3 ).

Embodiment 3

[0070] Embodiment 3 Recombinant bacteria LADF3L fermentation tank fermentation verification

[0071] Strains: LADF:E.coli BL21(DE3)pACYCDuet-hemLA pCDFDuet-hemD-hemF.

[0072] Recombinant Escherichia coli LADF was fermented and produced in a 3L fermenter with an inoculum size of 2%, an initial glucose concentration of 33g / L, and 0.1-0.5mMIPTG induction and corresponding antibiotics were added at 0h. As time changed, ALA began to accumulate in large quantities after 10h. At 30h, the ALA yield was the highest, which was 1800mg / L, and the fermentation period was significantly shortened ( Figure 4 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for building high-yield 5-aminolevulinic acid Escherichia coli engineering strains, and belongs to the field of metabolic engineering and micro-biological fermentation. On the basis that key enzyme glutamy tRNA reduction enzyme and glutamyl aminotransferase which are 5-aminolevulinic acid C5 synthesis paths are overexpressed through carriers pACYCDuet-1, uroporphyrinogen III synthase (UROS) hemD codes and coproporphyrinogen III oxidase (CPO) hemF codes from an escherichia coli heme biosynthetic pathway are independently expressed with pCDFDuet-1 or are expressed together, and recombination strains are constructed. By means of fermentation verification, hemD or hemF is expressed separated, hemD and hemF are expressed together, and the ALA yield is obviously improved.

Description

technical field [0001] The invention relates to a method for constructing a high-yield 5-aminolevulinic acid Escherichia coli engineering strain, belonging to the fields of metabolic engineering and microbial fermentation. Background technique [0002] 5-aminolevulinic acid (5-aminolevulinic acid, ALA), the molecular formula is C 5 o 3 NH 9 , with a molecular weight of 131.13 and a melting point of 149-151°C, it is the biosynthesis of chlorophyll, heme, and vitamin B 12 and other key precursor substances. As a safe, selective, and permeable photodynamic drug, ALA has gradually attracted attention in the medical field, and has been successfully used in the diagnosis and photodynamic therapy of skin cancer, bladder cancer, digestive tract cancer, and lung cancer. In addition, as a new photoactivated pesticide with high environmental compatibility and high selectivity, ALA is widely used in the field of pesticides, such as a pollution-free green pesticide, herbicide and pla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/00C12R1/19
Inventor陈坚康振堵国成张俊丽
OwnerJIANGNAN UNIV