Construction method and application of humanized mouse model

A humanized and sequenced technology, applied in the construction and application of humanized mouse models, can solve problems such as no background data, no key technologies, and no technical standards.

Inactive Publication Date: 2014-09-17
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Five genetically modified mouse models (including CB6F 1 -Tg RasH2, Tg.AC, C57BL / 6(N5)-Trp53 + / - 、Xpa - / - 、Xpa - / - / P53 + / - ) Although the experimental period is only 24-26 weeks, and the incidence of false positives and false negatives is low, they also generally have inconsistent responses to genotoxic and non-genotoxic carcinogens. Defects such as unclear boundaries of human carcinogens (E.M.Agency, 2004, Evaluation of Medicines for Human Use, CPMP / SWP / 2592 / 02Rev1:1-12; J.MacDonald et al., 2004, Toxicological Sciences., 77:188-194 ; J.B.Pritchard et al., 2003, Environmental Health Perspectives, 111:444-454)
In the field of carcinogenicity evaluation using genetically modified animals, my country is still in the "four noes" state: no commercial animal models are available for sale, no technical standards are available, no key technologies are available, and no background data are available (Fan Changfa et al., 2009 , Laboratory Animal Science, 26:59-61)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of humanized mouse model
  • Construction method and application of humanized mouse model
  • Construction method and application of humanized mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Example 1: Query, order and PCR identification of human BAC clones.

[0090] By searching the Ensemble Genome Browser to determine the region of Nbs1 and its upstream and downstream DNA sequences of at least 50kb on the chromosome, and minimize the existence of other genes, the human BAC clone numbered CH17-246C15 was screened from the NCBI Clone DB Qualified (see Figure 1). Ordered BAC clones (CHORI) are stored in DH10B host cells and mailed with agar as a carrier. The strain was streak cultured, and expanded after inoculation. Then use 2 pairs of specific primers located at the 5' and 3' of the c.657del5 mutation site to carry out bacterial liquid PCR identification on the purchased BAC strains. The primer sequences are as follows:

[0091] hNbs1-657tF: TGTCACCTGCCACCATATTTCTAG (SEQ ID NO: 1)

[0092] hNbs1-657tR: CCGTAATCACAGCCATGATCACT (SEQ ID NO: 2)

[0093] PCR amplification conditions: 94°C for 5min, 35* (94°C for 30sec, 55°C for 30sec, 72°C for 30sec), 72°C ...

Embodiment 2

[0094] Embodiment 2: the construction of gene carrier

[0095] Step 1. Using the pRpsl-neo plasmid (donated by the Vector Group of the Institute of Model Animals, Nanjing University) as a template, the rpsl-neo fragment was obtained by PrimeSTAR high-fidelity PCR (TaKaRa), which contained: 1319bp rpsl-neo, c.657del5 mutation The 61bp homology arm (l-hm) at the 5' end of the site and the 61bp homology arm (r-hm) at its 3' end. The primer sequences are as follows:

[0096] hNbs1-657hF: CTCTTGATGAACCATCTATTGGAAGTAAAAATGTTGATCTGTCAGGACGGCAGGAAAGAAAGGCCTGGTGATGATGGCGGGATCG (SEQ ID NO: 3)

[0097] hNbs1-657hR:TTAGCTTATAACATAATTACCTGTTTGGCATTCAAAAATATAAATGTTTTCCCTTTGAAGATCAGAAGAACTCGTCAAGAAGGCG (SEQ ID NO: 4)

[0098] PCR amplification conditions: 95°C for 5min, 5* (98°C for 15sec, 55°C for 15sec, 72°C for 2min), 26* (98°C for 15sec, 65°C for 15sec, 72°C for 2min), 72°C for 5min, and keep warm at 4°C. The product fragment was 1441bp, and then subjected to agarose gel electrophores...

Embodiment 3

[0130] Example 3: Analysis of Nbs1 c.657del5 Transcriptional characterization of human Nbs1 in transgenic mice.

[0131] Step 1. Extraction and inversion of RNA from different tissues.

[0132] The 8-week-old mice were killed, and 10 kinds of tissues (colon, liver, spleen, heart, muscle, kidney, brain, testis, lung, thymus) were quickly taken and placed in 500ul RNAiso Plus (TaKaRa) with 0.5M NaOH Homogenize rapidly in solution with a tissue homogenizer (PT2100, Kinematica). The homogenate was extracted with 1 / 5 volume of chloroform, then an equal volume of isopropanol was added to precipitate the total RNA, the precipitate was washed with 75% ethanol, and dissolved in DEPC-H 2 O middle. Then determine the OD value and correct it, use RT reagent Kit (TaKaRa) reverse transcribed 1ug RNA to obtain cDNA.

[0133] Step 2: RT-PCR detection of transcription characteristics of human Nbs1.

[0134] Using cDNA as a template, two pairs of specific primers located at the 5' end an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method and application of a humanized mouse model, in particular to a construction method and application of a transgenic mouse model of a human Nbs1<c.657del5> gene. The method includes: constructing a 5bp deletion mutation-containing BAC carrier in the human Nbs1 gene, conducting pronuclei microinjection, and performing screening to obtain 3 stable transgenic lines for high expression and low expression of the human Nbs1 gene. The transgenic mouse involved in the invention has the phenotypes of delayed puberty, uniform shortening of body length and bone dysplasia at certain proportion in one of the lines, and a new mouse model is established for Nijmegen breakage syndrome diseases. At the same time, as the Nbs1 gene function impairment is closely related to cancers, the transgenic model can be applied to short-term carcinogenic tests in drug pre-clinical safety evaluation, thus providing a potential substitution model for traditional biennium carcinogenic tests and also providing an effective tool for research of carcinogenesis mechanisms.

Description

technical field [0001] The invention relates to a transgenic mouse model, in particular to a model that expresses NBS1 at a higher level in different developmental stages and organs p70 The construction method of the transgenic mouse model, and the animal model and embryos, cells, tissues and organs derived from it are used in the preclinical safety evaluation of drugs, carcinogen screening and drug screening for the treatment of NBS (Nijmegen Broken Syndrome) the use of. Background technique [0002] DNA repair systems and cell cycle checkpoint systems are directly related to genome stability. If cells cannot normally perform DNA double-strand break repair functions (homologous recombination repair and non-homologous end-joining repair), it will lead to chromosomal rearrangement and mutation accumulation, thereby activating cell cycle checkpoints and inhibiting growth. However, if it is used as the final detection, the cell cycle checkpoint arrest function is also impaire...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N5/10C12Q1/02A01K67/027
Inventor魏勤徐平
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI