Beta-amylase-trehalose synthase fused enzyme and expression gene and application thereof

A technology of trehalose synthase and gene expression, which is applied in the field of genetic engineering, can solve the problems of difficult separation of maltose and trehalose, difficult production conditions, and increased difficulty of separation and purification, so as to facilitate the control of process conditions and simplify the production process , Promote the effect of continuing to decompose starch

Active Publication Date: 2014-09-24
QILU UNIV OF TECH
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the joint action of the above two enzymes is not only difficult to control the production conditions, but also the intermediate product is maltose, and the separation of maltose and trehalose is relatively difficult, thus increasing the difficulty of subsequent separation and purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-amylase-trehalose synthase fused enzyme and expression gene and application thereof
  • Beta-amylase-trehalose synthase fused enzyme and expression gene and application thereof
  • Beta-amylase-trehalose synthase fused enzyme and expression gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of β-amylase expression vector, the steps are as follows:

[0047] The genomic DNA of Bacillus cereus was extracted, and the β-amylase gene fragment was amplified by PCR, and then the PCR amplified product was recovered from the gel, digested with restriction endonuclease BamHI / HindIII, and cloned into the same restricted Recombinant plasmid pET-BA was obtained by digesting the corresponding site of plasmid pET-28a with endonuclease BamHI / HindIII; the results are as follows: figure 1 shown.

[0048] Primer 1: 5'-CGCGGATCCATGAAAAATCAGTTTCAATATTGTTGTATTGTTGTTTTG;

[0049]Primer 2: 5'-CCCAAGCTTCCACCAACTTACATGAGAGGTAGTCTTCATTG;

[0050] The above PCR reaction system is shown in Table 1:

[0051] Table 1

[0052]

[0053] The above PCR reaction conditions: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 54°C annealing for 30 sec, 72°C extension for 2 min, a total of 30 cycles; 72°C supplementary extension for 10 min.

Embodiment 2

[0055] To obtain engineering bacteria, the steps are as follows:

[0056] (1) E. coli BL21 (DE3) strain (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) was inoculated on LB medium, and activated at 37°C overnight to obtain activated Escherichia coli;

[0057] (2) Pick a single colony of the activated Escherichia coli prepared in step (1) from the LB plate, inoculate it in 5 ml of fermentation medium, and culture it overnight with shaking at 37° C. until the late logarithmic growth period to obtain a bacterial suspension;

[0058] (3) Take the bacterial suspension prepared in step (2) and inoculate it into 100ml LB liquid medium at a ratio of 1:100 by volume, culture at 37°C, shake at 200r / min for 2.5h to OD 600 =0.5 (the early logarithmic phase), the Erlenmeyer flask was taken out and placed on ice for 15 minutes to prepare the bacterial solution;

[0059] (4) Pour the bacterial liquid from step (3) into a 50ml pre-cooled centrifuge tube under sterile conditions, ...

Embodiment 3

[0067] The construction of β-amylase and trehalose synthase fusion enzyme expression vector, the steps are as follows:

[0068] Using primer 3 and primer 4, the corresponding gene fragment of trehalose synthase in the genome of Pseudomonas putida was amplified in vitro (PCR). After restriction endonuclease digestion, it was cloned into the corresponding site of the vector pET-BA which was also digested with restriction endonucleases HindⅢ and XhoI to form the recombinant plasmid pET-BATS. Its structural map is as figure 2 shown. The PCR product is the corresponding gene fragment of trehalose synthase, the nucleotide sequence is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6.

[0069] Primer 3: 5'-CCGCTCGAGTCAAACATGCCCGCTGCTGTTGAC,

[0070] Primer 4: 5'-CCCAAGCTTGAAGCTGCGGCAAAAGAAGCTGCGGCAAAAGAAGCTGCGGCAAAAATGACCCAGCCCGACCCGTCATAC;

[0071] The above-mentioned PCR reaction system is shown in Table 3:

[0072] table 3

[0073]

[0074] The ab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a beta-amylase-trehalose synthase fused enzyme and an expression gene and application thereof. The amino acid sequence of the beta-amylase-trehalose synthase fused enzyme is as shown in SEQ ID NO.1; the nucleotide sequence of the expression gene of the beta-amylase-trehalose synthase fused enzyme is as shown in SEQ ID NO.2. According to the invention, beta-amylase and trehalose synthase are fused for the first time, and the obtained beta-amylase-trehalose synthase fused enzyme can be used for producing trehalose by utilizing amylose or straight-chain dextrin, and moreover the influence of substrate maltose on the separation of the product trehalose is reduced when the trehalose synthase acts on maltose to generate trehalose.

Description

technical field [0001] The present invention relates to β-amylase-trehalose synthase fusion enzyme and its expression gene and application, in particular to a β-amylase-trehalose synthase fusion enzyme which can produce trehalose by using amylose or amylose dextrin The expression gene and application thereof and the expression gene and application thereof belong to the technical field of genetic engineering. Background technique [0002] Trehalose (Trehalose, α-D-glucopyranosyl-α-D-glucopyranoside) is also known as sucrose and muscarinose, and its chemical name is α-D-glucopyranosyl-α-D-glucopyranoside. Trehalose was first isolated by researchers in Selaginell lepidophylla and subsequently isolated from the ergot fungus of rye in 1982. Trehalose is composed of two glucose molecules connected by α, α-1,1-glucosidic bonds, the reduced part of each glucose molecule is used to form α, α-1,1-glycosidic bonds, and there is no free aldehyde group, Therefore, trehalose is a non-re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/90C12N9/26C12N15/62C12N15/70C12N1/21C12P19/24C12P19/22C12P19/12C12R1/19
CPCC07K2319/00C12N9/2425C12N9/90C12P19/12C12P19/22C12P19/24C12Y302/01002C12Y504/99016
Inventor马春玲王瑞明李丕武王腾飞李猛
OwnerQILU UNIV OF TECH