Method for coproducing D-arginine and gamatine through biotransformation

A technology for agmatine and arginine, which is applied in the field of biotransformation and co-production of D-arginine and agmatine, can solve the problems of low yield, heavy pollution, and many steps in the chemical route, and achieve high Conversion rate, simple separation and purification, and high catalytic enzyme activity

Inactive Publication Date: 2014-11-19
洛阳华荣生物技术有限公司
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, what is currently used in industry is chemical production, which has many route steps, low yield and heavy pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for coproducing D-arginine and gamatine through biotransformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] A method for the co-production of D-arginine and agmatine by a biological method, the production method comprising the following steps:

[0061] Step 1, preparation of genetically engineered bacteria expressing arginine racemase

[0062] (1) Liquid culture Pseudomonas putida KT2440 strain, extract its genomic DNA, and set aside;

[0063] (2) Primers were designed according to the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank, and the designed primer sequences were as follows:

[0064] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is shown in SEQ ID NO: 1);

[0065] R-argR-BamHI:CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is shown in SEQ ID NO: 2);

[0066] According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s,...

Embodiment 2

[0085] A method for the co-production of D-arginine and agmatine by a biological method, the production method comprising the following steps:

[0086] Step 1, preparation of genetically engineered bacteria expressing arginine racemase

[0087] (1) Liquid culture Pseudomonas putida KT2440 strain, extract its genomic DNA, and set aside;

[0088] (2) Primers were designed according to the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank, and the designed primer sequences were as follows:

[0089] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is shown in SEQ ID NO: 1);

[0090] R-argR-BamHI:CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is shown in SEQ ID NO: 2);

[0091] According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s,...

Embodiment 3

[0110] A method for the co-production of D-arginine and agmatine by a biological method, the production method comprising the following steps:

[0111] Step 1, preparation of genetically engineered bacteria expressing arginine racemase

[0112] (1) Liquid culture Pseudomonas putida KT2440 strain, extract its genomic DNA, and set aside;

[0113] (2) Primers were designed according to the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank, and the designed primer sequences were as follows:

[0114] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is shown in SEQ ID NO: 1);

[0115] R-argR-BamHI:CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is shown in SEQ ID NO: 2);

[0116]According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for coproducing D-arginine and gamatine through a biological method. The method comprises the following steps: synthesizing arginine racemase genes argR according to a designed primer, establishing an expression vector pET24a-argR and transferring the expression vector into an Escherichia coli strain, thus obtaining genetically engineered bacteria of the arginine racemase; establishing an expression vector pET24a-speA through a speA gene segment amplified by PCR, transferring the expression vector pET24a-speA into Escherichia coli, thus obtaining L-arginine decarboxylase genetically engineered bacteria; stirring and reacting a transformation system containing L-arginine and a wet vector for expressing the genetically engineered bacteria of the arginine racemase, thus obtaining an enantiomer of L-arginine and D-arginine; removing the arginine racemase, supplementing a wet vector for expressing L-arginine decarboxylase, and continuously reacting until the L-arginine is completely consumed; and finally, separating and purifying the D-arginine and gamatine in the reaction system. The catalyzing enzyme activity is high, the separation and purification operations are simple, the raw materials are cheap, the total production cost is low; and the method has high conversion rate, can realize large-scale production and is suitable for industrial application.

Description

technical field [0001] The invention relates to a production method of D-arginine and agmatine, in particular to a method for co-producing D-arginine and agmatine through a biological method. Background technique [0002] D-arginine (D-arginine, D-arg), as the enantiomer of L-arginine, is a non-protein amino acid that exists in a small amount in the body. Studies have shown that D-arginine in organisms has unique physiological functions, such as inhibiting the proliferation of cancer cells, antihypertensive and so on. In addition, as a chiral component, D-arginine is also an important chiral reagent and pharmaceutical intermediate. [0003] D-arginine exists in a small amount in nature and is not easy to obtain through extraction. The current method is mainly to use chemical methods (such as salicylaldehyde method) to racemize L-arginine to obtain a mixture of DL-arginine, and then resolve it by chemical methods or biological enzyme catalysis to obtain chirally pure D - ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12P13/10C12P13/00C12R1/19
Inventor范文超丁鹏
Owner洛阳华荣生物技术有限公司