Method for coproducing D-arginine and gamatine through biotransformation
A technology for agmatine and arginine, which is applied in the field of biotransformation and co-production of D-arginine and agmatine, can solve the problems of low yield, heavy pollution, and many steps in the chemical route, and achieve high Conversion rate, simple separation and purification, and high catalytic enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0059] Example 1
[0060] A method for co-producing D-arginine and agmatine by biological method, and its production method includes the following steps:
[0061] Step 1: Preparation of genetically engineered bacteria expressing arginine racemase
[0062] (1) Culture the KT2440 strain of Pseudomonas putida in liquid and extract its genomic DNA for use;
[0063] (2) Design primers based on the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank. The designed primer sequence is as follows:
[0064] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is as SEQ ID NO:1);
[0065] R-argR-BamHI: CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is as SEQ ID NO: 2);
[0066] According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s, 53°C annealing, 30s, 72°C e...
Example Embodiment
[0084] Example 2
[0085] A biological method for co-producing D-arginine and agmatine, and the production method includes the following steps:
[0086] Step 1: Preparation of genetically engineered bacteria expressing arginine racemase
[0087] (1) Culture the KT2440 strain of Pseudomonas putida in liquid and extract its genomic DNA for use;
[0088] (2) Design primers based on the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank. The designed primer sequence is as follows:
[0089] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is as SEQ ID NO:1);
[0090] R-argR-BamHI: CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is as SEQ ID NO: 2);
[0091] According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s, 53°C annealing, 30s, 72°C extension, ...
Example Embodiment
[0109] Example 3
[0110] A biological method for co-producing D-arginine and agmatine, and the production method includes the following steps:
[0111] Step 1: Preparation of genetically engineered bacteria expressing arginine racemase
[0112] (1) Culture the KT2440 strain of Pseudomonas putida in liquid and extract its genomic DNA for use;
[0113] (2) Design primers based on the DNA fragment gene sequence of Pseudomonas putida KT2440 with the accession number AE015451.1 recorded in the global public sequence database Genebank. The designed primer sequence is as follows:
[0114] F-argR-NdeI: GGGCGGC CATATG CCCTTTCGCCGTACCCTTCTGG (its base sequence is as SEQ ID NO:1);
[0115] R-argR-BamHI: CAT GGATCC TCAGTCGACGAGTATCTTCGG (its base sequence is as SEQ ID NO: 2);
[0116] According to the designed primers, high-fidelity KOD polymerase was used for PCR amplification. The PCR reaction program was: 94°C pre-denaturation, 5min; 94°C denaturation, 30s, 53°C annealing, 30s, 72°C extension,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap