Supercharge Your Innovation With Domain-Expert AI Agents!

IRTKS gene-knocked out mouse model, construction method and application thereof

A technology of mouse model and construction method, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of human diabetes deviation, matching animal models, etc.

Inactive Publication Date: 2014-12-31
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, since diabetes is a group of clinical syndromes caused by the interaction of multiple genetic backgrounds and environmental factors, although many animal models of diabetes have been developed, they still deviate from human diabetes, and so far there is no one that is completely compatible with human diabetes. Compatible animal models

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IRTKS gene-knocked out mouse model, construction method and application thereof
  • IRTKS gene-knocked out mouse model, construction method and application thereof
  • IRTKS gene-knocked out mouse model, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1I

[0019] The construction of embodiment 1IRTKS-KO mice

[0020] 1. Construction of IRTKS-KO plasmid

[0021] see figure 1 (A), 80 μg of IRTKS KO Vector plasmid DNA was digested with NotI (enzyme dosage: 100U), digested in a volume of 200 μl, and digested overnight at 37°C; gel separation and purification, gel recovery kit using QIA quick Gel Extraction Kit (Cat No. .28706); followed by ethanol precipitation and resuspended in 100 μl sterile PBS (phosphate buffered saline).

[0022] 2. ES cell targeting and screening

[0023] The above-mentioned IRTKS-KO linearized plasmid was used for ES cell targeting.

[0024] ES cells (embryonic stem cells): SCR012

[0025] DNA amount: 35μg

[0026] Electrotransfer instrument model: Bio-Rad Gene Pulser (Cat.No.165-2105)

[0027] Electroporation conditions: set voltage 240V, capacitance 500μF, actual power-on time 10.5ms, actual voltage 256V

[0028] Cloning screening conditions: 300 μg / ml G418, 2 μM GanC screening for 8 days

[0029...

Embodiment 2I

[0047] Example 2 Genotype identification of IRTKS-KO mice and expression identification of IRTKS

[0048] 1. Genotyping homozygous, heterozygous, and wild-type mice

[0049] First, design two pairs of PCR identification primers to identify homozygous, heterozygous and wild mice, see figure 2 (A). The primer sequences are as follows:

[0050] F1: CTGCGGGCTGTTAAAGGTTA (SEQ ID No: 5)

[0051] F2: ACTCAGCGCTTGAGACTTG (SEQ ID No: 6)

[0052] F3: GATCTGCCAAGGAAAGACA (SEQ ID No: 7)

[0053] F4: GGGAACTTCCTGACTAGGG (SEQ ID No: 8)

[0054] PCR reaction system (50 μl): 5 units / μl TaKaRa rTaq 0.25 μl, 10×TaKaRa rTaq buffer 5 μl, dNTP mixed solution (each concentration 2.5 mM) 4 μl, DNA template 500 ng or less, forward primer and reverse primer 0.2- 1.0 μM, make up the volume to 50 μl with sterilized distilled water.

[0055] PCR reaction conditions: 95°C for 10 minutes; 95°C for 10 seconds, 59°C for 30 seconds, 72°C for 40 seconds, a total of 33 cycles; 72°C for 5 minutes.

[0...

Embodiment 3 3

[0069] Example 3 Analysis of glucose metabolism in three groups of mice (male homozygous, heterozygous, wild)

[0070] 1. The fasting blood glucose of IRTKS-KO (IRTKS gene knockout homozygous), IRTKS-WT (wild type) and IRTKS-HET (heterozygous) mice was detected by Roche Accu-chek, and the results are shown in image 3 (A);

[0071] 2. After 3.5-month-old mice were fasted for 6 hours, 50 μl-100 μl of blood was collected by orbital puncture, centrifuged at 5000 rpm for 5 minutes, and the supernatant was taken, and IRTKS was detected with the mouse insulin ELISA kit (Cat#EZRMI-13K) of Millipore Company -KO, IRTKS-WT and IRTKS-HET mice serum insulin values, see the results image 3 (B);

[0072] 3. 3.5-month-old mice were fasted overnight, and 1.5g / kg glucose was injected intraperitoneally with a 1ml syringe at six time points before injection (0) and 15, 30, 60, 90, and 120 minutes after injection. The blood glucose value of each mouse was measured, and the mean and standard ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a construction method for an IRTKS gene-knocked out mouse model. According to the method, homologous recombination is adopted, and a 2.0-kb PGK / Neo sequence is adopted to substitute for the exon1 sequence containing the ATG initiation codon in the mouse IRTKS gene so as to obtain the IRTKS gene-knocked out mouse model. The present invention further discloses the IRTKS gene-knocked out mouse model constructed by using the method, and the application of the model in diabetes research. According to the present invention, results of pathological analysis and detection of carbohydrate, insulin and the like confirmed that the IRTKS gene-knocked out mouse can produce hyperglycemia, hyperinsulinemia, impaired glucose tolerance, decreased insulin sensitivity and the like, and are consistent with the disease characteristics of human so as to provide the good animal model for study on the diabetes pathogenesis and evaluation and screening of the treatment drugs.

Description

technical field [0001] The invention relates to animal models in the field of biotechnology, more specifically, to an IRTKS gene knockout mouse model, its construction method, and its application in diabetes research. Background technique [0002] Under the organization of the Diabetes Society of the Chinese Medical Association, from June 2007 to May 2008, an epidemiological survey of diabetes was conducted in 14 provinces and cities across the country. The results showed that the prevalence of diabetes among adults over 20 years old in my country was 9.7%. , men are higher than women, and the incidence rate gradually increases with age (the incidence rates of 20-39 years old, 40-59 years old, and greater than or equal to 60 years old are 3.2%, 11.5%, and 20.4%, respectively) , and the incidence rate of urban residents is higher than that of rural residents (respectively 11.4% and 8.2%), indicating that changes in lifestyle such as reduced exercise, unhealthy diet, and obesity...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/873A01K67/027A61K49/00
Inventor 韩泽广黄丽钰
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More