Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof

A technology of silkworm egg microspores and detection primers, which is applied to the field of LAMP detection primers of silkworm egg microsporidia, can solve the problems of long time consumption, disadvantageous mass detection or on-site detection, time-consuming and the like

Inactive Publication Date: 2015-02-25
SOUTH CHINA AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the PCR primers designed using this gene have many operating steps for the detection of Microsporidia silkworm, and it takes a long time, which is not suitable for field detection and other shortcomings, which is not conducive to the widespread promotion and use in actual production.
A bigger problem is that the existing public detection primers all use the DNA of microsporidia as a template, but the isolation and collection of microsporidia are complicated and time-consuming, which is extremely unfavorable for mass detection or on-site detection
[0004] On the other hand, microsporidia parasitize in silkworm eggs, and the content of silkworm eggs is significantly higher than that of the microsporidia to be detected. In the extracted DNA samples, both DNAs exist at the same time, and the DNA of silkworm silkworm eggs seriously affects the detection. Interference, therefore, if you want to directly use silkworm egg DNA as a template for the detection of microsporidia, higher requirements are put forward for the detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof
  • LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof
  • LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Example 1 Primer Design

[0091] 1. According to the sequence of the No. silkworm EB1 gene (Accession number: KF421134.1) verified by the laboratory through the transcriptome sequencing method and the clone sequencing method, the homology analysis was carried out by BLAST software, and no similar sequence was found. The invention designed a set of PCR primers with this gene as the target gene: primers EB1F and EB1R.

[0092] The sequence of primer EB1F (shown in SEQ ID NO:5) is:

[0093] 5' GGTCAACAGTAGAAAAGAGTTAGTG 3'

[0094] The sequence of primer EB1R (shown in SEQ ID NO: 6) is:

[0095] 5' CTTCTTTCTAAATCCTCAATTCTCTT 3'

[0096] 2. Use the above-mentioned PCR primers to detect healthy silkworm eggs and silkworm eggs infected with N. figure 1 shown).

[0097] Therefore, based on the position of the fragment amplified by the PCR primer, the EB1 gene was used as the target gene designed by the LAMP primer, and the online software Primer ExplorerV4 ( http: / / prim...

Embodiment 2

[0117] Embodiment 2 kit preparation

[0118] 1. The DNA template of the silkworm Microsporidia was prepared by using the plant mini-extraction kit of Qiagen Company, and the method was carried out according to the instructions. Specifically include the following steps:

[0119] S1. Take 200 μL microsporidia sample, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant; then add 50-100 μL ddH 2 O resuspension;

[0120] S2. Draw the resuspended spore liquid into the pre-cooled mortar, and grind it fully with liquid nitrogen (more than 3 times);

[0121] S3. Put the ground spores into a 1.5 mL centrifuge tube, add 400 μL lysis buffer AP1 and 4 μL RNase A, and vortex to mix (400 μL lysis buffer AP1 and 4 μL RNase A do not mix before use);

[0122] S4. Incubate the mixed solution at 65°C for 10 min (invert the test tube 2 to 3 times during the period);

[0123] S5. Add 130 μL buffer P3, mix and ice-bath for 5 minutes; then centrifuge at 14,000 rpm for 5 minutes;

[0...

Embodiment 3

[0141] Example 3 Kit detection method

[0142] 1. The LAMP reaction conditions of the kit are: constant temperature reaction at 63°C for 40-90 minutes; then inactivation at 95°C for 2 minutes.

[0143] 2. When staining or agarose gel electrophoresis is used to determine the test result, the reaction system of the kit is:

[0144] 2×Reaction Buffer 12.5μL

[0145] Primers EB1F3 / B3 and EB1FIP / BIP 1 μL

[0146] Bst DNA polymerase 8U / μL 1μL

[0147] Template DNA 2 μL

[0148] wxya 2 O 8.5 μL;

[0149] When the determination of the detection result adopts the real-time fluorescence method, the reaction system of the kit is:

[0150] 2×Reaction Buffer 12.5μL

[0151] Primers EB1F3 / B3 and EB1FIP / BIP 1 μL

[0152] Bst DNA polymerase 8U / μL 1μL

[0153] Fluorescent indicator 0.5μL

[0154] Template DNA 2 μL

[0155] wxya 2 O 8 μL;

[0156] Wherein, the concentration of the primer EB1F3 / B3 is 5 pmol / μL, and the concentration of the primer EB1FIP / BIP is 20˜40 pmol / μL. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) detection primer group for microsporidia in silkworm eggs and an application thereof. The primer group comprises outside primers EB1-F3 / EB1-B3 and inside primers EB1-FIP / EB1-BIP, wherein the sequences of the primers are shown in SEQIDNO:1-4. An LAMP detection method and kit for microsporidia in silkworm eggs are established by utilizing the primers. The kit comprises the primer group, 2*reaction buffer, positive control substances, negative control substances, a developing liquid (or a fluorescence staining liquid), Bst DNA (deoxyribonucleic acid) polymerase, a sealing liquid and sterile water. The results of detection carried out by adopting the method can be visually observed in natural light or be observed through agarose gel electrophoresis or be observed and determined via a real-time fluorescence curve. The method is easy to operate, has the advantages of short detection time, easiness in determination of results and strong specificity, and can be used for detecting the DNA, at a concentration of 5.0*10<-3>ng / mu L, of the eggs laid by the silkworms infected with nosema bombycis.

Description

technical field [0001] The invention belongs to the field of biotechnology. More specifically, it relates to a LAMP detection primer for Microsporidia silkworm eggs and its application. Background technique [0002] Bombyx mori microsporidia is a pathogenic microsporidium silkworm ( Nosema bombycis , N.b) It is a devastating disease that infects silkworms through ingestion or embryo (embryo) infection. It is also an important disease that affects the sustainable and stable development of my country's silk industry. The economic losses caused by the damage caused by particulate disease in various places every year Very tragic. At the same time, microsporidian insects in the wild can cross-infect silkworms, and can spread between silkworms and between different silkworms, resulting in the scrapping of a large number of silkworm eggs, which seriously restricts the trade of silkworm eggs and the sustainable development of sericulture. my country has listed silkworm micropartic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/6844C12Q2531/119C12N15/11C12Q1/04C12Q1/68Y02A50/30
Inventor 刘吉平程伟宋小景晏育伟
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More