LAMP (loop-mediated isothermal amplification) detection primers for microsporidia in silkworm eggs and application thereof
A technology of silkworm egg microspores and detection primers, which is applied to the field of LAMP detection primers of silkworm egg microsporidia, can solve the problems of long time consumption, disadvantageous mass detection or on-site detection, time-consuming and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Example 1 Primer Design
[0091] 1. According to the sequence of the No. silkworm EB1 gene (Accession number: KF421134.1) verified by the laboratory through the transcriptome sequencing method and the clone sequencing method, the homology analysis was carried out by BLAST software, and no similar sequence was found. The invention designed a set of PCR primers with this gene as the target gene: primers EB1F and EB1R.
[0092] The sequence of primer EB1F (shown in SEQ ID NO:5) is:
[0093] 5' GGTCAACAGTAGAAAAGAGTTAGTG 3'
[0094] The sequence of primer EB1R (shown in SEQ ID NO: 6) is:
[0095] 5' CTTCTTTCTAAATCCTCAATTCTCTT 3'
[0096] 2. Use the above-mentioned PCR primers to detect healthy silkworm eggs and silkworm eggs infected with N. figure 1 shown).
[0097] Therefore, based on the position of the fragment amplified by the PCR primer, the EB1 gene was used as the target gene designed by the LAMP primer, and the online software Primer ExplorerV4 ( http: / / prim...
Embodiment 2
[0117] Embodiment 2 kit preparation
[0118] 1. The DNA template of the silkworm Microsporidia was prepared by using the plant mini-extraction kit of Qiagen Company, and the method was carried out according to the instructions. Specifically include the following steps:
[0119] S1. Take 200 μL microsporidia sample, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant; then add 50-100 μL ddH 2 O resuspension;
[0120] S2. Draw the resuspended spore liquid into the pre-cooled mortar, and grind it fully with liquid nitrogen (more than 3 times);
[0121] S3. Put the ground spores into a 1.5 mL centrifuge tube, add 400 μL lysis buffer AP1 and 4 μL RNase A, and vortex to mix (400 μL lysis buffer AP1 and 4 μL RNase A do not mix before use);
[0122] S4. Incubate the mixed solution at 65°C for 10 min (invert the test tube 2 to 3 times during the period);
[0123] S5. Add 130 μL buffer P3, mix and ice-bath for 5 minutes; then centrifuge at 14,000 rpm for 5 minutes;
[0...
Embodiment 3
[0141] Example 3 Kit detection method
[0142] 1. The LAMP reaction conditions of the kit are: constant temperature reaction at 63°C for 40-90 minutes; then inactivation at 95°C for 2 minutes.
[0143] 2. When staining or agarose gel electrophoresis is used to determine the test result, the reaction system of the kit is:
[0144] 2×Reaction Buffer 12.5μL
[0145] Primers EB1F3 / B3 and EB1FIP / BIP 1 μL
[0146] Bst DNA polymerase 8U / μL 1μL
[0147] Template DNA 2 μL
[0148] wxya 2 O 8.5 μL;
[0149] When the determination of the detection result adopts the real-time fluorescence method, the reaction system of the kit is:
[0150] 2×Reaction Buffer 12.5μL
[0151] Primers EB1F3 / B3 and EB1FIP / BIP 1 μL
[0152] Bst DNA polymerase 8U / μL 1μL
[0153] Fluorescent indicator 0.5μL
[0154] Template DNA 2 μL
[0155] wxya 2 O 8 μL;
[0156] Wherein, the concentration of the primer EB1F3 / B3 is 5 pmol / μL, and the concentration of the primer EB1FIP / BIP is 20˜40 pmol / μL. ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com