A kind of recombinant streptomyces, its construction method and the method for improving antibiotic production
A technology of streptomyces and avermectin streptomyces, applied in the field of genetic engineering, can solve the problems of low fermentation unit and high production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Construction of ilvH gene expression vector
[0041] 1. Amplification of ilvH structural genes
[0042] Design primers to amplify the ilvH structural gene [NC_003155.4 (3353885..3354412)] located on the chromosome of Streptomyces avermitilis MA4680 (ATCC31267), that is, sequence 1 in the sequence list.
[0043] Upstream primer Primer F1: ATGAGCAAGCACACCCTCTCCGTCCT,
[0044] Downstream primer Primer R1: TTGTAAAACGACGGCCAGT GAATTC TTACGCGGATCGGTCCAGCGCGCGC,
[0045] The underlined base is the recognition site of restriction enzyme EcoRI, and the amplified product should be 557bp.
[0046] Using the total DNA of Streptomyces avermitilis MA4680 (ATCC31267) as a template, Primer F1 and Primer R1 as primers, and using Q5Hot Start High-Fidelity DNA Polymerase from New England Biolabs, PCR amplification was carried out under the following conditions: 98°C, 3min; (98°C, 10s; 72°C, 40s) × 30 cycles; 72°C, 2min. The amplified product was detected by agarose gel electrophoresis,...
Embodiment 2
[0055] Example 2. Transformation of recombinant plasmid
[0056] Because of the strong restriction and modification effect in Streptomyces avermectin, using E.coli DH5α to directly combine and transfer with Streptomyces avermectin has extremely low transformation efficiency, and sometimes even no transformants can be obtained. However, using E.coli ET12567 (PUZ8002) without restriction modification for binding transfer, the transformation efficiency is significantly improved. Therefore, the constructed recombinant plasmid was transformed into E.coli ET12567 (PUZ8002) (Kieser T, Bibb MJ, Buttner MJ, etal. Practical Streptomyces Genetics, 2000, Norwich: The John Innes Foundation.) to obtain non-methylation The DNA is then combined and transferred.
[0057] In this example, Streptomyces avermitilis MA4680 (ATCC31267) was selected as the starting strain, which produced off-white spores on the plate.
[0058] The E. coli ET12567 (PUZ8002) containing the ilvH gene expression plasmid pH-1...
Embodiment 3
[0060] Example 3. Fermentation research of recombinant strain
[0061] 1. Shake flask fermentation of Streptomyces avermectin
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


