Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of recombinant streptomyces, its construction method and the method for improving antibiotic production

A technology of streptomyces and avermectin streptomyces, applied in the field of genetic engineering, can solve the problems of low fermentation unit and high production cost

Active Publication Date: 2018-01-16
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production strain of Abamectin also has low fermentation units and high production costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of recombinant streptomyces, its construction method and the method for improving antibiotic production
  • A kind of recombinant streptomyces, its construction method and the method for improving antibiotic production
  • A kind of recombinant streptomyces, its construction method and the method for improving antibiotic production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Construction of ilvH gene expression vector

[0041] 1. Amplification of ilvH structural genes

[0042] Design primers to amplify the ilvH structural gene [NC_003155.4 (3353885..3354412)] located on the chromosome of Streptomyces avermitilis MA4680 (ATCC31267), that is, sequence 1 in the sequence list.

[0043] Upstream primer Primer F1: ATGAGCAAGCACACCCTCTCCGTCCT,

[0044] Downstream primer Primer R1: TTGTAAAACGACGGCCAGT GAATTC TTACGCGGATCGGTCCAGCGCGCGC,

[0045] The underlined base is the recognition site of restriction enzyme EcoRI, and the amplified product should be 557bp.

[0046] Using the total DNA of Streptomyces avermitilis MA4680 (ATCC31267) as a template, Primer F1 and Primer R1 as primers, and using Q5Hot Start High-Fidelity DNA Polymerase from New England Biolabs, PCR amplification was carried out under the following conditions: 98°C, 3min; (98°C, 10s; 72°C, 40s) × 30 cycles; 72°C, 2min. The amplified product was detected by agarose gel electrophoresis,...

Embodiment 2

[0055] Example 2. Transformation of recombinant plasmid

[0056] Because of the strong restriction and modification effect in Streptomyces avermectin, using E.coli DH5α to directly combine and transfer with Streptomyces avermectin has extremely low transformation efficiency, and sometimes even no transformants can be obtained. However, using E.coli ET12567 (PUZ8002) without restriction modification for binding transfer, the transformation efficiency is significantly improved. Therefore, the constructed recombinant plasmid was transformed into E.coli ET12567 (PUZ8002) (Kieser T, Bibb MJ, Buttner MJ, etal. Practical Streptomyces Genetics, 2000, Norwich: The John Innes Foundation.) to obtain non-methylation The DNA is then combined and transferred.

[0057] In this example, Streptomyces avermitilis MA4680 (ATCC31267) was selected as the starting strain, which produced off-white spores on the plate.

[0058] The E. coli ET12567 (PUZ8002) containing the ilvH gene expression plasmid pH-1...

Embodiment 3

[0060] Example 3. Fermentation research of recombinant strain

[0061] 1. Shake flask fermentation of Streptomyces avermectin

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombined streptomycete, a construction method of the recombined streptomycete and a method for increasing the antibiotic yield. The recombined streptomycete over-expresses acetolactic acid synthase small subunit ilvH. The recombined streptomycete over-expresses acetolactic acid synthase to adjust subunit genes, and the yield of products such as antibiotics for conducting secondary metabolism with L-isoleucine and / or L-valine and / or L-leucine as precursors / a precursor can be remarkably increased.

Description

Technical field [0001] The invention belongs to the field of genetic engineering, relates to a recombinant Streptomyces and its application, and specifically relates to improving the yield of antibiotics by modifying key genes in the synthetic pathway of antibiotic precursors. Background technique [0002] Streptomyces is a gram-positive actinomycete, which belongs to the genus Strptomyces in system biology and has a complex life cycle and secondary metabolic pathways. Many members of this genus can produce a variety of biologically active secondary metabolites. Of the tens of thousands of antibiotics currently known, more than 70% are produced by Streptomyces. In addition, it can also produce immunosuppressants, anti-tumor agents, insecticides and a variety of extracellular hydrolase enzymes, such as cellulase, amylase, pectinase and protease. [0003] In the process of Streptomyces producing secondary metabolites, amino acids can be used as carbon sources and nitrogen sources. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/76C12N15/60C12P19/62C12R1/465
CPCC12N9/88C12P19/623
Inventor 张立新刘钇君刘梅朱华张庆高鹤永刘新利帅辉唐丹
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com