Supercharge Your Innovation With Domain-Expert AI Agents!

Tetranychus cinnabarinus cytochrome p450 gene and application thereof

A technology of Tetranychus cinnabarinus and cytochrome, applied in the field of insect physiology and biology, to achieve the effect of reducing economic losses, reducing environmental problems, and good control effect

Inactive Publication Date: 2015-04-29
SOUTHWEST UNIVERSITY
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many problems in the traditional chemical control methods of Tetranychus cinnabarinus, such as the "3R" problem of pesticides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tetranychus cinnabarinus cytochrome p450 gene and application thereof
  • Tetranychus cinnabarinus cytochrome p450 gene and application thereof
  • Tetranychus cinnabarinus cytochrome p450 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Comparison of gene changes after Tetranychus cinnabarinus feeding on cowpea and cotton by expression profiling sequencing (gene screening)

[0026] The present invention firstly transfers Tetranychus cinnabarinus (this mite has been raised in the laboratory for more than 15 years without contacting any medicament) that feeds on cowpea seedlings raised indoors to cotton seedlings grown indoors. After feeding on cotton seedlings for 50 days, T. cinnabarinica whose hosts were cowpea seedlings (V-TC) and cotton seedlings (G-TC) were collected for total RNA extraction. Then BGI was commissioned to perform expression profiling sequencing on the extracted V-TC and G-TC total RNA. Finally, through the analysis of expression profile data, compared with V-TC, more than 500 differentially expressed genes were found in G-TC. At the same time, the obtained differential genes were compared and functionally annotated, and genes were classified according to different functions. Then,...

Embodiment 2

[0027] Example 2: Cloning the full length of the tcCYP1 gene

[0028] 1 Extraction of total RNA

[0029] The total RNA of Tetranychus cinnabarinus was extracted by the Trizol method (the operation steps were completely carried out in accordance with the instructions of the Trizol extraction of total RNA). The results of the extracted electropherograms are shown in figure 1 .

[0030] 2 cDNA first-strand synthesis.

[0031] The operation steps were carried out in accordance with the instructions of PrimeScript II 1st Strand cDNA Synthesis Kit (D6210A) of TAKARA Company.

[0032] 3-gene full-length PCR amplification

[0033] Primer5 software design specific primer sequence

[0034] TcCYP1-Forward: ATGTTGCTTCTTGATTACTTTAGTG

[0035] TcCYP1-Reverse: CGAAAAAATTTCCTTTTAA

[0036] The reagent composition of polymerase chain reaction is as follows:

[0037]

[0038]

[0039] The conditions for the polymerase chain reaction are as follows:

[0040]

[0041] 4 Purificati...

Embodiment 3

[0051] Example 3: Verification of gene differential expression

[0052] 1 Extraction of total RNA

[0053] The operation steps were carried out in full accordance with the instruction manual of Trizol extraction of total RNA.

[0054] 2 Synthesis of cDNA template

[0055] The operation steps completely refer to the TaKaRa PrimeScriptTM RT reagent Kit with gDNA Eraser kit

[0056] 3 Fluorescence quantitative PCR

[0057] Primer 3 software design quantitative primer specific sequence:

[0058] F-qtcCYP1:CGCCTTCGCAAATGATGCTT

[0059] R-qtcCYP1:TAACCGTCTGTGTTCACGCC

[0060] The system configuration is as follows:

[0061]

[0062] program:

[0063]

[0064] According to the CT value obtained from the qPCR results, the gene expression difference multiple was converted (using 2 -△△ct method), the results showed that compared with T. cinnabarinus that ate cowpea, the gene that ate cotton had more than 6-fold up-regulated expression, which was consistent with the express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a tetranychus cinnabarinus cytochrome p450 gene. The cDNA base sequence of the tetranychus cinnabarinus cytochrome p450 gene comprises the sequence shown in SEQ ID NO. 1. The invention also provides an amino acid sequence and a dsRNA sequences corresponding to the cDNA base sequence, as well as a recombinant expression vector, a transgenic cell line, a recombinant strain and an expression kit associated with the gene. The tetranychus cinnabarinus cytochrome p450 gene is used for cultivating transgenic cotton or can be used for preparing products for prevention and treatment of tetranychus cinnabarinus. After the tetranychus cinnabarinus eats the transgenic cotton, the expression amount of the in-vivo gene is significantly decreased, the egg laying amount is also significantly reduced which shows that more serious fitness cost exists. The tetranychus cinnabarinus cytochrome p450 gene provides novel genetic resource for the development on anti-mite transgenic plants and provides a new way for scientific and effective prevention of tetranychus cinnabarinus.

Description

technical field [0001] The invention relates to the field of insect physiology and biotechnology, in particular to a cytochrome P450 gene of Tetranychus cinnabarinus and its application in the creation of transgenic anti-mite cotton. Background technique [0002] Tetranychus cinnabarinus, also known as cotton spider mite, cotton spider mite, red spider mite, is distributed all over the world, and occurs in North China, East China, Central China, South China, Northeast China and other regions. The mite is a polyphagous agricultural pest, which mainly harms various crops such as cotton, beans, Solanaceae and corn. The individuals of Tetranychus cinnabarinus are very small, and it is difficult to find them with the naked eye; they have extremely strong reproductive ability, and they can lay a large number of eggs in a suitable growth environment; the generation cycle is short, and a certain number of populations can be quickly formed in a short period of time. Tetranychus cinn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/63C12N5/10C12N1/21C12N1/19C12N1/15C12N15/82A01H5/00
Inventor 何林肖月华张永军宋长贵卢文才敖已倩云
Owner SOUTHWEST UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More