Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus thuringiensis lts290, insecticidal gene cry57ab, expressed protein and its application

A Bacillus thuringiensis, insecticidal gene technology, applied in the application, insecticide, genetic engineering and other directions, can solve the problems of single, increasing insect resistance, and achieve the effect of delaying the resistance

Inactive Publication Date: 2017-11-14
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Since the current commercialized transgenic insect-resistant crops have relatively single types of insect-resistant genes, such large-scale promotion of planting has the risk of reducing pest refuges and increasing pest resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus thuringiensis lts290, insecticidal gene cry57ab, expressed protein and its application
  • Bacillus thuringiensis lts290, insecticidal gene cry57ab, expressed protein and its application
  • Bacillus thuringiensis lts290, insecticidal gene cry57ab, expressed protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, isolate Bacillus thuringiensis bacterial strain LTS290

[0034]The applicant's laboratory staff isolated a strain of Bacillus thuringiensis from the soil of Lalin Town, Wuchang City, Heilongjiang Province. The spores of Bacillus thuringiensis are spore outer wall, spore coat, cortex, spore inner wall, and plasma membrane from outside to inside. and protoplasts. The main component of the cortex is peptidoglycan, a polysaccharide teichoic acid that does not contain vegetative cells, which maintains the dehydration state and heat resistance of the spores. On the other hand, during the formation of the spores, a large amount of DPA-Ca will be produced. thuringiensis spores will not die after heat treatment at 80°C for 20 minutes, and the dormant spores are treated at a sub-lethal temperature of 75°C for 15 minutes, the activation effect is the best , not only promote its rapid germination, but also improve the survival rate of spores (Yu Ziniu 1990). Accordi...

Embodiment 2

[0052] Example 2. Obtaining new genes

[0053] Through whole-genome sequencing, it was found that the genome of strain BtLTS290 contained a cry gene with a high similarity to cry57Aa1, and a full-length primer 57F (5'CG GGATCC GATGGGGACATGGTGGCCT3') and 57R (5'CCC AACGTT ATTTGATAAATAATTAAATAAAGTATCAG3'), the 5' ends of the primers were respectively added restriction sites BamH I and Sal I, which have been underlined.

[0054] The new sip1A gene in the strain was isolated and cloned by rapid cloning method.

[0055] Using pfuDNA polymerase, PCR amplification was performed with the following system.

[0056]

[0057] Make up to 50 μL with ultrapure water, mix well and centrifuge.

[0058] Amplification cycle: denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, extension at 72°C for 1 minute, 25 cycles, and finally extension at 72°C for 10 minutes. Such as Figure 4 shown.

[0059] 2.2 Connection scheme

[0060]

[0061] Make up the volume to 10 μL w...

Embodiment 3

[0075] Embodiment 3, gene expression and activity assay

[0076] 3.1.1 Plasmid DNA was extracted from the above clones, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.

[0077] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.

[0078] The process of inducing expression is as follows:

[0079] 1) Activated strains (37°C, 12hr);

[0080] 2) 10% inoculated in LB medium (37°C, 2hr);

[0081] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;

[0082] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;

[0083] 5) Broken bacteria (ultrasonic crushing is complete);

[0084] Centrifuge at 12,000rpm for 10min at 4°C;

[0085] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.

[0086] The polyacrylamide gel configuration is as follows.

[0087]

[0088] Sample loading: 10-15μl sampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to "Bacillus thuringiensis LTS290, insecticidal gene cry57Ab, expressed protein and application thereof", belonging to the technical field of biological control. Bacillus thuringiensis LTS290, its preservation number is: CGMCC No.10232. The insecticidal protein isolated from strain LTS290 has the amino acid sequence shown in SEQ ID NO 2 and the gene encoding the insecticidal protein, preferably the nucleotide sequence of the gene is shown in SEQ ID NO1. The above-mentioned genes have certain toxicity to lepidopteran pests, and can be applied to transform microorganisms and plants to make them exhibit toxicity to related pests, and overcome and delay the generation of drug resistance of pests to engineering bacteria and transgenic plants.

Description

technical field [0001] The invention relates to the technical field of biological control, in particular to a Bt insecticidal gene with high toxicity to lepidopteran agricultural pests and a protein encoded by the gene. Background technique [0002] Bacillus thuringiensis (Bt) is a widely distributed Gram-positive bacterium, an entomopathogenic microorganism with strong toxicity to pests and no toxicity to natural enemies, and no toxicity to higher animals and humans. It is currently the most in-depth study and the most widely used microbial insecticide, and it is active against more than 3000 kinds of pests in 16 orders. Bt can form insecticidal crystal proteins (Insecticidal Crystal Proteins, ICPs), also known as δ-endotoxin (delta-endotoxin) during the sporulation stage, its shape, structure and size are closely related to its virulence [Schnepf.E, Crickmore .N,Van Rie.J.,Lereclus.D,Baum.J,Feitelson.J,Zeigler.D.R.,Dean.D.H.Bacillus thuringiensis and its pesticidal crysta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/00A01P7/04C07K14/325C12N15/32C12N15/75C12N1/21C12R1/07
CPCA01N63/00C07K14/325C12N15/8286C12N1/205C12R2001/07
Inventor 高继国李海涛刘荣梅周国旺张杰
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com