Preparation method of recombinant avian influenza subunit vaccine

An avian influenza subunit and avian influenza technology, applied in the field of preparation of avian influenza subunit vaccine, can solve problems such as difficult to achieve effective prevention, poor vaccine immunization effect, long vaccine production cycle, etc., and achieve low production cost and high immune effect Good, easy-to-operate effect

Inactive Publication Date: 2015-06-03
WUHAN SIQIYUAN BIOTECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Generally, chicken embryos are used for production. The virus grows in chicken embryos after adapting to chicken embryos, and the vaccine production cycle is long.
In addition, the virus is easy to mutate during the passage of chicken embryos, resulting in poor immune effect of the vaccine
It is difficult to achieve the purpose of effective prevention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombinant avian influenza subunit vaccine
  • Preparation method of recombinant avian influenza subunit vaccine
  • Preparation method of recombinant avian influenza subunit vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Cultivate the virus strain A / Anhui / 1 / 2013 (H7N9), and extract the RNA in the virus strain

[0022] The A / Anhui / 1 / 2013 (H7N9) was obtained from the Chinese Center for Disease Control and Prevention (CDC).

[0023] Inoculate 0.2 mL of avian influenza virus strain A / Anhui / 1 / 2013 (H7N9) into 15-day-old chicken embryos, culture at 37°C for 40 hours, place in a refrigerator at 4°C overnight, and collect allantoic fluid aseptically. Take 500mL of viral allantoic fluid and centrifuge at 6000rpm for 20min at 4°C to collect the supernatant, centrifuge at 25000rpm for 2h and ultracentrifuge, resuspend the pellet in 5mL TEN, centrifuge with a sucrose gradient with a mass fraction of 10%-40%, centrifuge at 35000rpm for 2h, and collect a mass fraction of 30% -35% viral bands, dialyzed to remove sugar, suspended in RNase-free TE buffer, aliquoted, and frozen.

[0024] Use the QIANGEN RNeasy Mini Kit kit to extract RNA. For specific steps, please refer to the instruction man...

Embodiment 2

[0025] Embodiment 2 utilizes reverse transcription PCR to obtain cDNA

[0026] Take 10 microliters of the RNA bacterial suspension, add 20 pmol of primer 1 (the nucleic acid sequence shown in SEQ ID NO: 3) and mix well, then place it in a water bath at 70 degrees Celsius for 10 minutes, then add 5* reverse transcriptase buffer, 0.1 mol / LDTT 2 microliters, 2.5mmol / LdNTP 4 microliters, RNase inhibitor 1 microliter, M-MLV reverse transcriptase 10U, 37 degrees Celsius water bath for 1 hour, 97 degrees Celsius for 10 minutes. Obtain cDNA.

Embodiment 3

[0027] The cDNA obtained in Example 3 is used as a template to amplify the HA gene

[0028] Configure the reaction solution according to the following reaction system:

[0029] cDNA (50ng / μL)

1μL

Primer 1 (10 μmol / L)

1μL

Primer 1 (10 μmol / L)

1μL

Taq DNA polymerase

1μL

10*Taq DNA polymerase buffer

5μL

dNTP (2.5mmol / L)

4μL

ddH2O

Make up 50μL

[0030] Amplify the HA gene according to the following reaction conditions:

[0031]

[0032] Primer 1 has a nucleic acid sequence as shown in SEQ ID NO: 3, that is, CCG GGTACC ATGAACACTCAAATCCTCGT, and has a KpnI restriction site.

[0033] Primer 2 has a nucleic acid sequence as shown in SEQ ID NO: 4, that is, AAT AAGCTTTTAGATACAGATTGTGCAGC, and has a HindIII restriction site.

[0034] The expanded HA gene has a nucleic acid sequence as shown in SEQ ID NO: 1, namely:

[0035] ATGAACACTCAAATCCTCGTTTTCGCCCTCATCGCCATCATCCCCACTAACGCTGATAAGATCTGCCTCGGTCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of a recombinant avian influenza subunit vaccine. The preparation method of the recombinant avian influenza subunit vaccine comprises the following steps: culturing a virus strain A / Anhui / 1 / 2013(H7N9), and extracting RNA in the virus strain; obtaining cDNA by utilizing reverse transcription PCR; amplifying a gene HA by taking the obtained cDNA as a template; constructing a recombinant expressing plasmid containing the gene HA, and expressing in Sf9 cells; and culturing cells containing the recombinant expressing plasmid, collecting, and purifying a recombinant avian influenza vaccine. The preparation method of the recombinant avian influenza subunit vaccine has the advantages of simple steps, good immune effect, low production cost and high yield, and is easy to operate and applicable to large-scale production.

Description

technical field [0001] The invention belongs to a preparation method of an avian influenza subunit vaccine, in particular to a preparation of a recombinant avian influenza subunit vaccine, a recombinant plasmid and a recombinant virus. Background technique [0002] Avian influenza is an acute respiratory infectious disease caused by some strains of certain subtypes of avian influenza A virus. The large-scale outbreak of animal avian influenza not only brings serious losses to farmers, but also endangers human health and brings significant economic losses. [0003] Animal bird flu vaccines are generally used to prevent and treat animal bird flu. [0004] In the prior art, inactivated virus strains are generally selected to prepare vaccines. Chicken embryos are generally used for production, and the virus grows in chicken embryos after adapting to chicken embryos, and the vaccine production cycle is long. In addition, the virus is easy to mutate during the passage of chicke...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/145A61P31/16C12R1/93
Inventor王华瑞李永亮
OwnerWUHAN SIQIYUAN BIOTECH