Check patentability & draft patents in minutes with Patsnap Eureka AI!

A gene recombination method for high-yielding rhamnolipid in Pseudomonas aeruginosa

A technology of Pseudomonas aeruginosa and rhamnolipid, which is applied in the field of bioengineering, can solve the problems of unstable production performance of strains, easy reversion of physical and chemical mutagenesis, etc., and achieve the effect of reducing production costs and promoting high yield

Active Publication Date: 2019-01-25
XIAN HAIGE BIOTECH RES INST CO LTD +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the production strain of rhamnolipid is mainly Pseudomonas aeruginosa (Pseudomonas aeruginosa). It is very easy to reverse the mutation, resulting in the instability of the production performance of the strain. In 1994, the research found that the genes rhlA and rhlB involved in the synthesis of rhamnolipids were considered to be the glycosyltransferase genes necessary for the synthesis of rhamnolipids. Further research was carried out in 2003 Determined that RhlA is an acyltransferase and is required for the synthesis of HAA (alkyl acyl acid), while HAA (β-hydroxydecanoyl-β-hydroxydecanoic acid) and TDP-rhamnose are precursors for the synthesis of rhamnolipids body substance, and HAA is also an extracellular biological surface active substance. RhlB is the key gene that catalyzes the reaction of TDP-rhamnose and HAA to generate rhamnolipid containing a rhamnosyl group. In Pseudomonas aeruginosa, rhlAB It exists in the form of an operon. Under this operon, a total of three proteins can be encoded, RhlA, RhlB and RhlR. These three genes have their own stop codons, but due to the presence of ribose in front of their promoters The body binding site, so that the next gene is expressed, we can use this feature to directly amplify the RhlAB gene and express it in other bacterial species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene recombination method for high-yielding rhamnolipid in Pseudomonas aeruginosa
  • A gene recombination method for high-yielding rhamnolipid in Pseudomonas aeruginosa
  • A gene recombination method for high-yielding rhamnolipid in Pseudomonas aeruginosa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The present invention will be further described below in conjunction with specific implementation.

[0033] Construction of rhamnolipid-producing Pseudomonas aeruginosa engineered bacteria

[0034] 1) Primer design for PCR amplification of RhlAB gene

[0035] Primers were designed according to literature reports and the gene sequence of rhamnolipid synthase RhlAB was searched on NCBI for amplifying the RhlAB gene (including the rhamnosyltransferase's own promoter and structural genes RhlA, RhlB).

[0036] WA: sense: gaatcgaattcatgcggccgaaagtctgt EcoRI 30nt

[0037] WB: anti-sense: cggtaagctttcaggacgcagccttcagcc HindIII 30nt

[0038] 2) PCR amplification of the target gene

[0039] Using the chromosome of wild-type rhamnolipid-producing Pseudomonas aeruginosa (preservation number: CCTCC NO: M2011287) as a template, PCR reaction was performed. After the reaction, the PCR product was subjected to agarose gel electrophoresis, and the kit was used for The target gene was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A genetic recombination method for high rhamnolipid-producing Pseudomonas aeruginosa, including the following steps: designing primers for amplifying the RhlAB gene based on the rhamnolipid synthase RhlAB gene sequence to use wild-type rhamnolipid-producing aeruginosa The chromosome of Pseudomonas is used as a template to perform a PCR reaction to amplify the RhlAB gene, and a purification kit is used to extract and purify the target gene. The purified RhlAB gene is enzymatically digested and transferred into Escherichia coli-Pseudomonas aeruginosa for shuttle expression. In the vector pAK1900, a new plasmid pAK1900‑AB was obtained. The constructed expression vector pAK1900‑AB was introduced into the competent cells of the recipient bacterium Pseudomonas aeruginosa by heat shock transformation, and the carboxyl-resistant plate was coated , PCR verified the constructed engineering bacteria; shake flask fermentation, and the sulfate-anthrone method was used to determine the production of rhamnolipids, which greatly reduced the production cost of rhamnolipids and laid the foundation for the industrial application of rhamnolipids. It has the advantage of promoting high production of rhamnolipids.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a gene recombination method for high-production rhamnolipids of Pseudomonas aeruginosa. Background technique [0002] Rhamnolipid is a glycolipid anionic surfactant, it has good biocompatibility and efficient emulsifying, solubilizing and reducing surface tension, etc. And food processing and other fields have broad application prospects. [0003] At present, the production strain of rhamnolipid is mainly Pseudomonas aeruginosa (Pseudomonas aeruginosa). It is very easy to reverse the mutation, resulting in the instability of the production performance of the strain. In 1994, the research found that the genes rhlA and rhlB involved in the synthesis of rhamnolipids were considered to be the glycosyltransferase genes necessary for the synthesis of rhamnolipids. Further research was carried out in 2003 Determined that RhlA is an acyltransferase and is required fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/78C12N15/54C12P19/44C12R1/385
Inventor 孙叶芳陈新玲薛姝雯
Owner XIAN HAIGE BIOTECH RES INST CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More