Supercharge Your Innovation With Domain-Expert AI Agents!

Carbonyl reductase gene, encoding enzyme, vector, strain and application

A technology of reductase and carbonyl, applied in the field of carbonyl reductase gene, can solve the problem of low catalytic efficiency

Active Publication Date: 2019-08-30
ZHEJIANG UNIV OF TECH
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The currently reported catalytic asymmetric reduction of tert-butyl (S)-6-chloro-5-hydroxy-3-carbonylhexanoate to tert-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate with high stereoselectivity Some strains include Lactobacillus kefir and Saccharomyces cerevisiaeCGMCC No.2233, etc., but the catalytic efficiency is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase gene, encoding enzyme, vector, strain and application
  • Carbonyl reductase gene, encoding enzyme, vector, strain and application
  • Carbonyl reductase gene, encoding enzyme, vector, strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Acquisition of Rhodosporidium toruloides (Rhodosporidium toruloides) ZJB2014212

[0056] The present invention takes soil samples from Zhejiang, Hubei, Anhui, Jiangsu and other places, and takes 30 soil samples altogether. The specific method of screening: Weigh 5g of soil sample, add 50mL of sterile water to make soil suspension, take 1.0mL of supernatant, add it to the screening medium, shake and cultivate at 30°C, 150rpm / min on a shaker for 48h. Take the culture solution for gradient dilution, take 10 -5 、10 -6 and 10 -7 Gradient dilutions of the above samples were spread on LB solid medium, and cultured in a constant temperature incubator at 30°C for 48 hours. The grown single colony was picked and inoculated into the liquid fermentation medium for cultivation. Cultivate on a shaker at 30°C for 48 hours, collect the cells by centrifugation, and wash with phosphate buffer. The cells are used for transformation, and the transformation conditions are as ...

Embodiment 2

[0067] Example 2: Amplification of the carbonyl reductase gene rtscr9

[0068]According to the whole genome sequencing information of Rhodosporidium toruloides (Rhodosporidium toruloides) ZJB2014212, the carbonyl reductase with potential catalytic activity was excavated, one of which has the ability to catalyze N,N-dimethyl-3-keto-3-(2-thienyl) The enzyme capable of generating (S)-N,N-bismethyl-3-hydroxyl-3-(2-thienyl)propanamide from propionamide hydrochloride is the carbonyl reductase RtSCR9 involved in the present invention.

[0069] Using Ambion's The reagents were used to extract the total mRNA of Rhodosporidium toruloides ZJB2014212 cells. 1mg of mRNA was taken as a template, and it was reverse transcribed to synthesize cDNA using the ReverTra Ace qPCR RT kit (ToYoBo, Japan). Using the cDNA as a template, PCR amplification was performed under the action of primer 1 (ATGTCTTCGCCTACTCCCAACGTC) and primer 2 (CTACCATGGCAAGAACGTCCCGTC). PCR reaction system (total volume 5...

Embodiment 3

[0072] Embodiment 3: Construction of recombinant Escherichia coli BL21(DE3) / pET28a-rtscr9

[0073] Design expression primer 3 ( catatg TCTTCGCCTACTCCCAACGTC), primer 4 ( aagctt CTACCATGGCAAGAACGTCCCGTC), and Nde I and Hind III restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the priming of primer 3 and primer 4, the high-fidelity Pfu DNA polymerase was used to amplify to obtain a 759bp carbonyl reductase gene sequence (its nucleotide sequence is shown in SEQ ID NO: 1), and after sequencing, use The amplified fragment was treated with Nde I and Hind III restriction enzymes (TaKaRa), and the fragment was treated with the commercial vector pET28a (Invitrogen) treated with the same restriction enzymes using T4 DNA ligase (TaKaRa). Connected to construct the expression vector pET28a-rtscr9. The constructed expression vector pET28a-rtscr9 was transformed into Escherichia coli BL21(DE3) (Invitrogen), spread on LB plates contain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a carbonyl reductase derived from Rhodosporidium toruloides ZJB14212, a gene, a vector, a strain and an application of the carbonyl reductase in the preparation of chiral drug intermediates. The above carbonyl reductase can biologically catalyze preparation of highly optically pure (S)-N,N-dimethyl-3-hydroxy-3-(2-thienyl)propionamide, (S)-N-methyl-3-hydroxy-3-(2-thienyl)propionamide, (R)-3-chloro-1-(2-thienyl)1-propanol, ethyl (S)-3-hydroxy-3-(2-thienyl)propanoate, (S)-3-hydroxy-3-(2-thienyl)propionitrile, tert-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate, (4S)-3-[(5S)-5-(4-fluorophenyl)-5-hydroxyvaleryl]-4-phenyl-1,3-oxazolidine-2-one and methyl [S-(E)]-2-[3-[3-[2-(7-chloro-2-quinolyl)vinyl]phenyl]-3-hydroxypropyl]benzoate.

Description

[0001] (1) Technical field [0002] The invention relates to a carbonyl reductase gene extracted from Rhodosporidium toruloides ZJB2014212, encoding enzyme, carrier, strain and application. [0003] (2) Background technology [0004] Stereoselective carbonyl reductase (Specific Carbonyl Reductase, SCR; Ketoreductase, KRED, EC 1.1.1.x) is a class of enzymes that can catalyze a bidirectional reversible redox reaction between alcohols and aldehydes / ketones, and requires the coenzyme NAD (H ) (nicotinamide adenine dinucleotide) or NADP(H) (nicotinamide adenine dinucleotide phosphate) as the hydrogen transporter. NADH and NADPH participate in the reduction reaction as electron donors, and NAD and NADP participate in the oxidation reaction as electron acceptors. At present, stereoselective carbonyl reductases are mainly distributed in three superfamilies: Short-Chain Dehydrogenase / Reductases (SDRs), Medium-Chain Dehydrogenases / Reductases (MDRs). ) and Aldo-Keto Reductases (Aldo-Ket...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/04C12N15/70C12N1/21C12P13/02C12P7/62C12P13/00C12P17/14C12N1/16C12R1/645
Inventor 柳志强郑裕国陈翔林超平王亚军吴林姚丹凯余道褔胡忠梁董思川沈寅初
Owner ZHEJIANG UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More