Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method, reagent, primers and probes for isothermal rapid detection of Ebola virus at room temperature

An Ebola virus, normal temperature and isothermal technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve problems such as undiscovered reports, achieve portable operation, and prevent false positives Simple effect of interference, detection operation requirements

Inactive Publication Date: 2018-10-02
ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, RAA nucleic acid amplification technology has been used at home and abroad to establish new detection methods for some pathogenic microorganisms, such as dengue virus, Salmonella enterica, Mycobacterium tuberculosis and methicillin-resistant Staphylococcus aureus, etc. This technology was used in Ebola Virus detection has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, reagent, primers and probes for isothermal rapid detection of Ebola virus at room temperature
  • Method, reagent, primers and probes for isothermal rapid detection of Ebola virus at room temperature
  • Method, reagent, primers and probes for isothermal rapid detection of Ebola virus at room temperature

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Embodiment 1: Screening of primers

[0047]With reference to 20 EBOV NP gene sequences published on GenBank, the inventors of the present application have carried out a more in-depth study on the information such as the genome, protein structure and function of the NP of EBOV, and the content of the NP gene in EBOV is higher, the present invention The NP gene of EBOV was selected as the target gene. A large number of experiments show that different primers have certain influence on the effect and sensitivity of isothermal amplification. Therefore, in this study, three pairs of different primers were initially designed for the NP gene of EBOV-Z subtype: NP-1, NP-2 and NP-3 (as shown in Table 1), these sequences can be combined with EBOV-S subtype The corresponding sequence of the NP gene specifically binds.

[0048] Table 1: Sequences of primers and probes

[0049]

[0050] image 3 It is the electrophoresis pattern of the effect of primers on the amplification ef...

Embodiment 2

[0055] Example 2: Fluorescence reverse transcription RAA detection

[0056] This example is used to illustrate the fluorescent reaction at room temperature and constant temperature on the Twista instrument.

[0057] 1. According to the NP gene sequence of Ebola-Zaire virus (EBOV-Z) that has been published on NCBI GenBank, the NP gene of Ebola-Zaire virus has been fully synthesized.

[0058] 2. Based on the design principles of primers and fluorescent probes, a pair of primers (NP-3-F and NP-3-R) and a fluorescent probe (NP-Probe) were designed according to the NP gene sequence of Ebola virus. As shown in table 2:

[0059] Table 2 Sequences of primers and probes of Ebola virus NP gene

[0060]

[0061] *(F) is a fluorescent group (Fluorophore), (H) is a tetrahydrofuran residue (THF residue), (B) is a quenching group (Quencher), and the 3' end is modified by Spacer C3 (Biotin-TEG).

[0062] 3. The components of the lyophilized powder reaction unit are:

[0063] Table 3 Co...

Embodiment 3

[0070] Example 3: Fluorescence reverse transcription RAA detection of influenza A virus

[0071] This example is used to illustrate the feasibility of fluorescent reverse transcription RAA to detect actual samples.

[0072] 1. According to the gene sequence of influenza A virus matrix protein that has been published on NCBI GenBank, perform sequence homology analysis to find a gene sequence with high homology, as shown below:

[0073] 5’-ATGAGTCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCGTCAGGCCCCCTCAAAGCCGAGATAGCGCAGAGACTTGAAGATGTTTTTGCAGGGAAAAACACCGATCTTGAGGCACTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAAAGCCCTCAATG’

[0074] 2. Based on the principle of primer and fluorescent probe design, a pair of primers (FluA-M-F and FluA-M-R) and a fluorescent probe (FluA-M-Probe) were designed according to the conserved sequence of the above-mentioned influenza A virus matrix protein. As shown in Table 5:

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method, a reagent, a primer and a probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions. The method, the reagent, the primer and the probe have the advantages that the Ebola viruses can be quickly, sensitively and accurately detected by the aid of the method in real time under the constant-temperature and isothermal conditions, nucleic acid targets can be quickly detected in instruments with fluorescence detection functions under the combined actions of the specific primer, the specific fluorescence probe, six engineering enzymes and other chemical constituents, closed-tube detection can be guaranteed by strict experiment operation steps, and aerosol pollution can be effectively prevented; the method, the reagent, the primer and the probe are applicable to detecting the Ebola viruses by the aid of diversified fluorescence detection devices.

Description

technical field [0001] The invention is a new technology and application in the field of Ebola virus detection, and relates to a method for rapid, real-time and specific detection of Ebola virus under normal temperature and isothermal conditions. It has broad application prospects in the fields of security, biosecurity and agriculture. Background technique [0002] Ebola virus (EBOV) can cause an acute hemorrhagic, zoonotic infectious disease-Ebola hemorrhagic fever (Ebola hemorrhagic fever, EHF). The virus was first identified in 1976 in the Ebola River region of southern Sudan and the Democratic Republic of Congo (formerly known as Zaire) and was named Ebola hemorrhagic fever because it caused systemic hemorrhage in patients. EBOV belongs to the Filoviridae family. It is a long filamentous, single-stranded negative-stranded RNA virus with an outer envelope. The pure virion is composed of a helical ribonucleocapsid complex, containing a negative-stranded linear RNA molecul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/70C12Q2521/507C12Q2521/101C12Q2522/101C12Q2563/107
Inventor 刘国宪曹伟周国辉程奇
Owner ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More