Cellobiose hydrolase mutant

A cellobiose and mutant technology, applied in the field of enzyme engineering, can solve the problems of high fermentation cost, large enzyme consumption, limited application of lignocellulose, etc., and achieve the effects of improving saccharification rate and strong acid resistance

Active Publication Date: 2015-12-23
QINGDAO VLAND BIOTECH GRP
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing cellobiohydrolase has low activity, high enzyme consumption, high fermentation cost, and its enzymatic hydrolysis efficiency and conversion rate are generally low under acidic conditions, which severely limits the application of lignocellulose in bioethanol production. Applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cellobiose hydrolase mutant
  • Cellobiose hydrolase mutant
  • Cellobiose hydrolase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1: Screening of cellobiohydrolase mutant genes

[0019] In order to improve the enzyme activity of wild-type cellobiohydrolase AF7A (the amino acid sequence is SEQIDNO: 1, the coding nucleotide sequence is SEQIDNO: 2, synthesized by Shanghai Sangon Bioengineering Co., Ltd.) under acidic conditions, through directed evolution Technology has carried out a large number of mutation screening of the enzyme, and designed PCR primers AF7A-F1 and AF7A-R1 as follows:

[0020] AF7A-F1: GGC GAATTC ATGATGCTGGCCTCCACCTTCTCC (the underline is the restriction endonuclease EcoRI recognition site);

[0021] AF7A-R1: ATAGCGGCCGCCTACAGGCACTGAGAGTAATAATC (the underline is the restriction enzyme NotI recognition site);

[0022] With the wild-type cellobiohydrolase AF7A gene SEQIDNO: 2 as template, utilize above-mentioned primer to carry out PCR amplification with GeneMorphII random mutation PCR kit (Stratagene), glue recovers PCR product, EcoRI, NotI carry out enzymatic treatment...

Embodiment 2

[0027] Example 2: Construction and verification of cellobiohydrolase mutant recombinant strains

[0028] (1) Protoplast preparation

[0029] Take the spore suspension of Trichoderma reesei (Trichodermareesei) SCHD4 strain, inoculate it on a PDA plate, and cultivate it at 30°C for 6 days; Powder, 1% glucose, 0.1% uridine) liquid medium, 30 ° C, 220rpm shaking culture for 14 ~ 16h;

[0030] Collect the mycelium by filtration with sterile gauze, and wash once with sterile water; place the mycelium in a conical flask containing 20mL of 10mg / mL lyase solution (SigmaL1412), 30°C, 90rpm for 1-2h; observe with a microscope Detection of protoplast transformation progress;

[0031] Pre-cooled 20mL1.2M sorbitol (1.2M sorbitol, 50mM Tris-Cl, 50mM CaCl 2) into the above Erlenmeyer flask, shake gently, collect the filtrate by filtering with sterile Miracloth filter cloth, centrifuge at 3000rpm at 4°C for 10min; discard the supernatant, add pre-cooled 5mL1.2M sorbitol solution to suspend ...

Embodiment 3

[0040] Embodiment 3 fermentation verification and enzyme activity assay

[0041] Inoculate the above-mentioned Trichoderma reesei engineering bacteria MAF7A (Trichoderma reesei MAF7A) and Trichoderma reesei engineering bacteria AF7A (Trichoderma reesei AF7A) on a PDA plate, culture at 30°C for 1 day, and after the spores are abundant, take two pieces of hyphae with a diameter of 1 cm to inoculate In 50mL fermentation medium containing (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH 4 ) 2 SO 4 , 0.09% MgSO 4 , 2% KH 2 PO 4 , 0.04% CaCl 2 , 0.018% Tween-80, 0.018% trace elements) in a 250mL Erlenmeyer flask, cultivated at 30°C for 48 hours, then cultivated at 25°C for 48 hours, and took the fermentation supernatant for SDS-PAGE electrophoresis detection and analysis. The result is as figure 1 As shown, the protein bands at 70kDa indicated by arrows in swimming lanes 1 and 2 are cellobiohydrolase AF7A and mutant MAF7A respectively, thereby illustrating that ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of enzyme gene engineering modification, particularly a cellobiose hydrolase mutant. The amino acid sequence of the cellobiose hydrolase mutant is SEQ ID NO:3, and one nucleic acid sequence of the coding gene is SEQ ID NO:4. The cellobiose hydrolase mutant provided by the invention has higher acid resistance than the wild type, the optimal pH is 5.0, and the cellobiose hydrolase mutant can keep the enzyme activity level of 65% or above within the pH range of 3.5-7.0; and the optimal pH of the wild type is 5.5. The cellobiose hydrolase mutant can be widely used for lignocellulose degradation, and can obviously enhance the saccharification rate of the lignocellulose. The saccharification rate of lignocellulose of the cellobiose hydrolase mutant MAF6A in the experimental group 2 is enhanced by 6.5% as compared with the control group, and enhanced by 3.5% as compared with the experimental group 1 with the wild type cellobiose hydrolase AF6A, thereby obtaining unexpected technical effects.

Description

technical field [0001] The invention belongs to the technical field of enzyme engineering, and in particular relates to a cellobiohydrolase mutant and its application in lignocellulose degradation. Background technique [0002] Cellulases are enzymes that hydrolyze cellulose (beta-1,4 glucan or beta-D-glycosidic linkages) leading to the formation of glucose, cellobiose, cellooligosaccharides and the like. Cellulases have traditionally been divided into three main types: endoglucanases (EC3.2.1.4), exoglucanases (exoglucanases) or cellobiohydrolase (cellobiohydrolase, EC3 .2.1.91) and β-glucosidase (β-D-glucosideglucohydrolase, EC3.2.1.21). Endoglucanase mainly acts on the non-crystalline part of cellulose fibers, whereas exoglucanase cellobiohydrolase is the only enzyme component that can act on crystalline cellulose. Therefore, the presence of cellobiohydrolases in the cellulase system is essential for efficient solubilization of crystalline cellulose. [0003] Cellobioh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12P7/06C12R1/885
CPCC12N9/2437C12P7/065C12Y302/01091Y02E50/10
Inventor李宾张青李瑞王华明黄亦钧许丽红许韦
OwnerQINGDAO VLAND BIOTECH GRP